Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

Russian military convoy has advanced from Ivankiv to outskirts of Kyiv, satellite images show (17 miles long)
CNN ^ | February 28th, 2022 | Paul P. Murphy

Posted on 02/28/2022 8:10:18 PM PST by Mariner

A Russian military convoy that was outside of Ivankiv, Ukraine, on Sunday has since made it to the outskirts of Kyiv, satellite images show.

On Sunday, the convoy was roughly 40 miles northwest of the Ukrainian capital, according to images provided by Maxar Technologies.

Maxar said that roughly 17 miles of roadway is chocked full of the convoy, which consists of armored vehicles, tanks, towed artillery and other logistical vehicles.

The private US company said the convoy was located on the T-1011 highway at Antonov air base around 11:11 a.m local time.

Antonov is roughly 17 miles from the center of the Ukrainian capital.

(Excerpt) Read more at cnn.com ...


TOPICS: Foreign Affairs; News/Current Events; Russia
KEYWORDS: accordingtoplan; aholesandoligarchs; alexanderlukashenko; asplanned; belarus; bidensfolly; chechens; chechnya; coldwarjunkies; deadrussianhomos; deadrussians; deathtochechnya; deathtoputin; deathtorussia; eurowankers; genius; ghostofkiev; globohomo; grannygreenparty; holodomor; isaidbudlight; lakhtabot; lukashenko; maxartechnologies; militarygenius; moldova; momoneymomoney; moskva; mumsiemaximus; natosfailing; newworldorder; nyuknyuknyuk; odesa; odessa; pedosforputin; poordoomedwangers; putin; putinlovertrollsonfr; putinsbuttboys; putinthehomo; putinworshippers; ramzankadyrov; russia; russianaggression; russianatrocities; russianhomos; russiansuicide; russianwarcrimes; russianwarcriminals; scottritter; sergeyshoigu; siloviki; smartandsavvy; theholodomor; tombofbakhmut; tothelastukie; transnistria; trostyanets; trustzelsplan; ukenazistoast; ukraine; vladimirsolovyov; vladtheimploder; vlodtheimpaled; wagnergroup; warinukraine; warpigs; wgafdamant; whiteflagofazov; yevgenyprigozhin; yousankmybattleship; zeeperfap; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovevindman; zelenskyy; zottherussiantrolls
Navigation: use the links below to view more comments.
first previous 1-20 ... 6,541-6,5606,561-6,5806,581-6,600 ... 6,661-6,676 next last
To: AdmSmith
In Russia they want to ban abortion and the dollar. Everything can happen this year.

The success of the idea of ​​​​banning divorces in Russia prompted Alexander Dugin to submit two more proposals to the president. Vladimir Putin, according to Kremlin sources, will consider them in the coming weeks.

Dugin’s first idea is a complete ban on abortion in Russia. We will write more about it soon, but now sources have provided several details. Alexander Gelyevich proposes to introduce a complete ban on abortion in the summer-autumn of this year . Women who have had or wanted to have an abortion are planned to be punished with serious fines. Doctors who will carry out such operations will receive prison sentences. A separate issue is abortions for medical reasons; here, according to interlocutors around Dugin, “there may be certain relaxations.”

The second idea is Russia's complete abandonment of the dollar and euro. This is not the first time Dugin has suggested that the president do this ( we wrote more about what a ban and penalties for currency transactions could be here ). But now, after the United States imposed sanctions against the Moscow Exchange, “the chances of such a ban, and in the near future, have increased,” believe Alexander Gelyevich’s associates.

Sources in the Kremlin cannot yet predict Vladimir Vladimirovich's reaction to Dugin’s proposals.

At the same time, our interlocutor at the Central Bank hopes that the president “will not listen to stupid advice” about the dollar. Otherwise, the situation with the American currency exchange rate may begin to develop according to a “tragic scenario.” We wrote about which one exactly last year.

https://t.me/kremlin_secrets/4230

6,561 posted on 06/13/2024 9:52:15 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6559 | View Replies]

New US sanctions against Russia have caused an immediate suspension of trading in dollars and euros on the country's leading financial marketplace, the Moscow Exchange.

The exchange, also known as MOEX, and the Russian central bank rushed out statements Wednesday, a public holiday in Russia, within an hour of Washington announcing a new round of sanctions aimed at cutting the flow of money and goods to sustain Moscow's war in Ukraine. Many Russians hold savings in dollars or euros, mindful of periodic crises in recent decades when the ruble has crashed in value. The central bank reassured people these deposits were secure.

Dollar-ruble trading volume on MOEX tends to be around 1 billion rubles ($11 million) a day, while euro-ruble trading hovers at around 300 million rubles ($3 million) daily. For yuan-ruble trading, daily volumes now regularly top 8 billion rubles ($90 million).

https://edition.cnn.com/2024/06/13/investing/us-russia-sanctions-dollar-euro-trading/index.html

6,562 posted on 06/13/2024 10:01:28 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT “Due to the introduction of restrictive measures by the United States again)
[ Post Reply | Private Reply | To 6561 | View Replies]

Are we facing a dollar worth 200 rubles? And what will happen to prices?

We talked with sources in the Central Bank about what will happen to the exchange rate now and whether we should believe the horror stories that are being spread in Russia after the imposition of sanctions against the Moscow Exchange . In particular, about the serious increase in the dollar exchange rate.

“Now a lot will be decided on the black market. Unfortunately, there is nothing to be done about it. At the same time, I urge you not to believe in panicky forecasts about the dollar at 200 rubles. Yes, there may be a serious currency shortage. Yes, the exchange rate may rise, even up to 120-130 rubles per dollar . Fluctuations of up to 150 are possible (although unlikely). But the stories about 200 rubles per dollar are the machinations of enemies,” says one of the interlocutors.

However, he refused to give advice on whether it is worth buying currency now. And he urged not to panic.

According to another source at the Central Bank, the real problem may not be the dollar exchange rate, but rising prices. “We hope that by the end of the year prices will increase no more than 5-10%. But the new sanctions are really painful. Therefore, everything can get out of control, and prices will rise by 20-30%, even more. We are fighting this scenario,” he stated. And he also urged not to panic.

https://t.me/kremlin_secrets/4232

6,563 posted on 06/13/2024 10:05:16 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT “Due to the introduction of restrictive measures by the United States again)
[ Post Reply | Private Reply | To 6562 | View Replies]

To: AdmSmith; Alter Kaker; Apparatchik; AZJeep; babble-on; BeauBo; bert; blitz128; buwaya; ...

VIDEOS

1. Russian soldier begs to surrender in harrowing frontline video as Ukraine halts Putin’s latest push
The Sun
5.39M subscribers
6-13-2024 7:00 a.m. EDT
https://www.youtube.com/watch?v=g25Ksapkd2w

2. The Russian Rouble is COLLAPSING! Why now?
Jake Broe [I am a United States Air Force veteran who served as a Nuclear and Missile Operations Officer (13N).]
466K subscribers
6-13-2024 7:00 p.m.EDT
https://www.youtube.com/watch?v=FXsHD1Hac5Q

3. 12 Jun: RESISTANCE WAS FUTILE. Russians Surrender IN LARGE NUMBERS in Vovchansk | War in Ukraine
Reporting from Ukraine
505K subscribers
6-12-2024
5:58 Minutes
https://www.youtube.com/watch?v=tD9TAKVT-8c

⚠️ Watch RFU in 20 languages: https://www.youtube.com/@RFU/channels

I am Ukrainian. My country has been invaded by Russia. In this video, I will tell you what happened on the 840 day of the war.

Day 840: Jun 12

Today, there are a lot of updates from the Kharkiv direction.

The situation in Vovchansk has seen significant developments as Ukrainian forces intensified their counterattacks and recaptured even more ground. Different analyst reports indicate substantial gains by Ukrainian forces, who have managed to recapture key positions to the west and northeast of the city.

In a significant development, Ukrainian forces recently conducted their first-ever strike with fighter jets on Russian territory, targeting a Russian command center and massive ammo depot near Belgorod. The strike resulted in a large-scale fire with secondary detonations, causing fear among the local population.

This attack underscores the shift in the operational landscape following the authorization by all Western partners for Ukraine to attack targets on Russian soil with Western weapons, including aviation bombs. It shows the way for Ukrainian forces to significantly damage logistic efforts to supply material to Russian forces participating in the Kharkiv offensive.

This event is undoubtedly part of the shaping operations in an attempt to undermine Russian supplies and facilitate Ukrainian counter-offensive efforts. The original uncensored videos of this strike can be found on our Telegram channel.

According to different Russian military analysts and also the Vovchansk City Military Administration, Ukrainian forces have recently retaken several positions within the settlement. Ukrainian officers have confirmed that most of Vovchansk remains under Ukrainian control, suggesting that recent tactical counterattacks have been successful in driving Russian forces out of central areas, with some Russian soldiers now surrounded and cut off.

Reports indicate that Ukrainian forces are increasing their efforts in the northern part of Vovchansk, attempting to eliminate the salient by recapturing territory block by block to the west. For their part, in what appears to be a desperate attempt, the Russians are still trying to attack the industrial zone around the aggregate plant located in the south, where Ukrainian forces have concentrated their primary area of force buildup. This movement puts Russian forces at an evident risk of being cut off if Ukrainian advances to the West continue at their current pace.

Recent geolocated footage shows the success of Ukrainian counterattacks. The first video shows a Russian soldier walking unarmed along a Vovchanks street to the Ukrainian side because he decided to surrender and remain alive. This soldier was most likely part of one of the groups that were cut off and surrounded. Those who did not surrender willingly were assaulted and still captured if they survived. A huge number of recently released videos show newly captured Russians along the whole contact line. Due to the sensitive nature of the footage, we can publish them only on our Telegram channel, which is accessible using the link in the description.

In general, apart from the high-rise buildings in the Citadel area in the center of the city and the industrial buildings in the southern part, both in the hands of Ukrainian forces, there are not many other areas in the city that could provide a sufficient level of fortification for Russian forces. Most of the buildings in the northern part of Russian control are residential houses on one or two floors at most. This means that Russian forces could be forced to withdraw to a position already outside the city on the northern outskirts of Vovchansk.

On the eastern side of the city, Ukrainian forces have recaptured a significant area of the settlement and continued their advance to the north. However, they have thus far advanced through urban areas. If we look at the topographic map, we can see that just next to these recaptured areas lies a high-altitude area, which may present more significant challenges for the continuation of Ukrainian advances.

German media military expert Julian Röpcke stated that Ukrainian troops recaptured new positions in the northeast of Vovchansk, while Russian troops continued to withdraw and counterattack lost areas with aircraft, missiles, and artillery. According to the German expert, to transfer reinforcements from the southern to the northern bank...

[Follow along using the transcript found at URL]

🔴 STREAMING VIDEO - live 6-13-2024 10:00 p.m.

RUSSIAN ECONOMY COLLAPSES, MOSCOW ON FIRE! Breaking Ukraine War News With The Enforcer (Day 841)
5.5K watching
The Enforcer
https://www.youtube.com/watch?v=HySJD1LKDYA

The Russian economy is collapsing at an exceptionally fast rate, panic has ensued with Russians attemtping to withdraw all of their money out of the banks. At the same time Russian forces in Kharkiv are taking atronomical losses according to NATO officials. The Sukhoi design Bureau has caught on fire and appears to have burned to the ground from video reports. Meanwhile the USS Helena has arrived in Cuba for “Routine Patrols.”


6,564 posted on 06/13/2024 10:11:26 PM PDT by UMCRevMom@aol.com (Pray for God 's intervention to stop Putin's invasion of Ukraine 🇺🇸)
[ Post Reply | Private Reply | To 6563 | View Replies]

To: AdmSmith
Russian Offensive Campaign Assessment, June 13, 2024

The United States finally sanctioned the Moscow Exchange, other significant Russian financial institutions, and Russian defense manufacturers 839 days into Russia's full-scale invasion of Ukraine. The US Department of the Treasury announced on June 12 sanctions against more than 300 individuals and entities supporting Russia's wartime economy, including the Moscow Exchange and its subsidiaries; major banks VTB Bank, Sberbank, and Tochka Bank; and leading Russian defense industrial base (DIB) entities including state owned defense conglomerate Rostec, the state owned aerospace and defense company United Aircraft Corporation, vehicle and vehicle components manufacturer Kamaz, main Russian tank manufacturer Uralvagonzavod, and helicopter design and manufacturing company Russian Helicopters.[10] The UK also announced similar sanctions targeting Russian financial institutions, entities supporting the Russian DIB, and Russia's shadow fleet of oil tankers.[11]

The Russian government appears confident that these new sanctions will minimally impact the Russian financial system, and the delay in US and other Western countries sanctioning these entities has given the Russian financial system time to prepare and mitigate such sanctions. The Moscow Exchange immediately suspended trading in US dollars (USD), euros, and Hong Kong dollars (HKP) in several markets on June 12 following the US sanctions announcement, and the Russian Central Bank instituted a fixed exchange rate for over-the-counter trading using the USD and euro on June 13.[12] Western and some Russian media widely circulated reports of some Russian banks appearing to sell USD to Russians at 100-200 rubles per dollar on June 12 and 13, but prominent Russian banks Sberbank and VTB quickly announced on June 12 that the new US sanctions would not impact their operations.[13] The Russian Central Bank has prepared for these sanctions and developed a procedure in October 2022 for setting currency exchange rates when it cannot obtain such data from the Moscow Exchange (data the Moscow Exchange can presumably no longer provide for USD).[14] The Russian Central Bank began publishing information on over-the-counter foreign exchange trade in April 2024.[15] The Russian Central Bank set its rubles per USD exchange rate for June 14 to 88.2080, only 88 kopecks lower than the previous rate, and the ruble-to-euro exchange rate only decreased by 91 kopecks to 94.8342 rubles per euro.[16] Bloomberg reported that multiple Russian metals producers and a fertilizer maker are not worried about the end of USD-ruble exchange trading and that Russian state-owned gas monopoly Gazprom has not used the Moscow Exchange for settlements “in a long time.”[17] Russian Security Council Deputy Chairperson Dmitry Medvedev complained about the new US sanctions, claiming that Russia is stable enough that it does not need to react to these sanctions out of economic need but that Russia should inflict “maximum harm” on the West in reaction to these sanctions because the United States and its allies “declared war on us [Russia] without rules.”[18] Medvedev’s choice to publish this only on his Russian language Telegram account indicates he likely means to posture strength and stability to a domestic Russian audience rather than address international audiences.

Bloomberg assessed on June 13 that the new US sanctions would make it more difficult for Russian businesses to trade on the international market due to the increased costs of over-the-counter trading and reduced foreign willingness to do business with Russian entities due to the fear of secondary sanctions.[19] A source close to the Russian Central Bank told Bloomberg that Chinese banks will gradually reduce their cooperation with the Moscow Exchange given these issues but that these banks will still provide yuan liquidity to support imports. The source also stated that there is uncertainty whether the Russian Central Bank's new exchange rates will work and how much costs of foreign trading and business will rise.

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-june-13-2024

6,565 posted on 06/13/2024 10:45:06 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT “Due to the introduction of restrictive measures by the United States again)
[ Post Reply | Private Reply | To 6558 | View Replies]

To: AdmSmith

VIDEO

Horrifying Moment! How Ukraine Quickly Destroys 64 Artillery and 82 Russian Combat Vehicles in A Day
U.S. Defense News
173K subscribers
Jun 13, 2024
8:09 Minutes
https://www.youtube.com/watch?v=ohpw9TlY1Ps

Russia continues to lose equipment at a vast rate in its full-scale invasion, according to Ukraine, whose latest figures suggest that June is on track for its most considerable monthly losses of artillery systems for the whole war.

A post on X (formerly Twitter) from the ministry’s official page reported the figures, which include the loss of 64 artillery systems, 6 tanks, 20 armored personnel vehicles (APVs), and 56 vehicles and fuel tanks.


6,566 posted on 06/13/2024 11:13:39 PM PDT by UMCRevMom@aol.com (Pray for God 's intervention to stop Putin's invasion of Ukraine 🇺🇸)
[ Post Reply | Private Reply | To 6564 | View Replies]

To: UMCRevMom@aol.com
>>>>I am Ukrainian. My country has been invaded by Russia.<<<<

I am an American. My country is being invaded by terrorists, barbarians and future welfare recipients from Third World countries who are pouring in through our intentionally unsecured borders.

Making sure these illegals have money, housing, food, healthcare, educations, clothing, etc., is more important to my government than helping my Brother Vets and me, as is securing Ukraine's border and funding their corrupt government.

iamanamericanveteran75181750b6dfc2a7.jpg

Why don't you care about Americans mommy?

6,567 posted on 06/14/2024 9:38:55 PM PDT by bimboeruption (“Less propaganda would be appreciated.” JimRob 12-2-2023)
[ Post Reply | Private Reply | To 6564 | View Replies]


6,568 posted on 06/14/2024 11:50:52 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT “Due to the introduction of restrictive measures by the United States again)
[ Post Reply | Private Reply | To 6552 | View Replies]


6,569 posted on 06/14/2024 11:52:50 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT “Due to the introduction of restrictive measures by the United States again)
[ Post Reply | Private Reply | To 6560 | View Replies]

From July 1, the price of all strong alcohol will increase. The minimum price of vodka will increase from 281 to 299 rubles, cognac - to 556 rubles, brandy - to 403 rubles per 0.5 liter. The rise in prices is caused by inflation, an increase in excise tax rates on alcohol and rising production costs

https://t.me/bankrollo/28253


6,570 posted on 06/14/2024 11:57:19 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT “Due to the introduction of restrictive measures by the United States again)
[ Post Reply | Private Reply | To 6563 | View Replies]

A side effect of the meat grinder:

The labor shortage in trade has become the worst in the last 20 years - AKORT. Job openings at grocery chains have grown nearly 60% since 2022. In the segment of non-food stores, clothing and footwear, the shortage of personnel increased by more than 50%, and in the market of household appliances and electronics - by more than 40%.

https://t.me/bankrollo/28251


6,571 posted on 06/15/2024 12:07:33 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT “Due to the introduction of restrictive measures by the United States again)
[ Post Reply | Private Reply | To 6570 | View Replies]

To: AdmSmith; marcusmaximus; Monterrosa-24; ought-six; PIF; USA-FRANCE; Apparatchik; BroJoeK; ...

The rumors of Russian economic collapse and runs on banks caused by new European and US financial sanctions is probably warming to many hearts. Actions based on the US dollar, the Euro, and the HongKong dollar seem to be the main source of Russia’s distress.

Does this explain why Putin has suddenly made a big announcement—for peace talks (a cease fire?), if only Ukraine will give him the 4 eastern Ukraine regions, and agree to NOT join NATO. I don’t think I heard Crimea mentioned in this proposal. Is Putin trying to NOT have his precious Kerch Bridge bombed, by suggesting Ukraine might end up with Crimea??? What is the significance of including the HongKong Dollar? Is this a threat against China, or does China secretly want to put pressure on Putin to end the disasterous world wide economic effects of his ego war? Putin himself said something about ending this fight which is having bad consequences for many countries in the world.

If he thinks Ukraine and Europe are going to roll over and give him eastern Ukraine, Putin is F-ing nuts. Perhaps all he hopes is that he can tell his own people, “See, I tried,” and they will believe him. He is probably getting a lot of pressure from the Oligarcks.

What a mean trick, imposing these nasty sanctions on a day of Russian national celebration.


6,572 posted on 06/15/2024 12:10:41 AM PDT by gleeaikin ( Question authority)
[ Post Reply | Private Reply | To 6562 | View Replies]

To: AdmSmith

On your last line, did you mean that Putin is NOT happy, or he is SO happy?


6,573 posted on 06/15/2024 12:13:19 AM PDT by gleeaikin ( Question authority)
[ Post Reply | Private Reply | To 6554 | View Replies]

To: gleeaikin

Just a typo: no happy => not happy


6,574 posted on 06/15/2024 12:47:28 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT “Due to the introduction of restrictive measures by the United States again)
[ Post Reply | Private Reply | To 6573 | View Replies]

To: gleeaikin

Would be very interesting to know what is going on between putin and xi. Seems very likely that Putin has made Russia subservient to China

Pitins “peace offer” would be like Hitler offering the allies a peace agreement in the beginning of June 44 that lets him keep everything he has, actually worse. It would be like him demanding parts of the east he no longer controlled as well.

On the surface putin, like Hitler seems to have some leverage. He controls lands in Ukraine. His army is still large and attacking, but things are not going well.

I think he knows this, though not sure how clear a picture he really has, and this “peace offer” is a trial ballon to see what happens.

Reminds me a bit of the idea that if the Germans had been able to reach Antwerp that would cause a split within the Allie’s and lead to a peace agreement. Not likely, just extend the war and more death and destruction

Ukraine faces an existential threat to its existence even with this peace agreement, but what is not talked about much is the existential threat putin faces if things go badly for Russia

Pretty sure the s500 system will be destroyed soon and his bridge will be hit as well. Along with that I see reversals on the battlefield and a Kharkiv like debacle resulting in loss of occupied territory combined with economic challenges may bring out the long knives

What Putin and his inner circle does at that point is anybodies guess.


6,575 posted on 06/15/2024 3:35:03 AM PDT by blitz128
[ Post Reply | Private Reply | To 6572 | View Replies]

To: gleeaikin

Proposal: a standard political disruption tactic.


6,576 posted on 06/15/2024 6:46:21 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 6572 | View Replies]

To: gleeaikin

Putin’s nonsense ‘peace’ proposal was meant to assuage his critics at home, not abroad. He’s not serious and so the war will continue until every last Ruzzian is expelled from Ukraine.


6,577 posted on 06/15/2024 8:18:50 AM PDT by MeganC (❤️❤️❤️❤️❤️❤️❤️)
[ Post Reply | Private Reply | To 6572 | View Replies]


6,578 posted on 06/15/2024 9:53:32 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT “Due to the introduction of restrictive measures by the United States again)
[ Post Reply | Private Reply | To 6569 | View Replies]

Shoigu wants to re-bury the ashes of commander Suvorov. But two things stand in the way.

According to our sources close to Sergei Shoigu, he believes that the ashes of the great commander Alexander Suvorov , who were taken out of the grave in March and carried along the front line, need to be buried again. “Sergei Kuzhugetovich is confident that the ashes of Alexander Vasilyevich fulfilled their role. Both at the front and for him personally. And that it can be returned to its burial place in the Alexander Nevsky Lavra,” said the interlocutor, surrounded by the Secretary of the Security Council.

Two things are preventing Shoigu from implementing these plans. Firstly, Suvorov’s remains were damaged during shelling at the front. And the military does not know how to return them to the grave in incomplete form. “The bones of one of the legs and part of the skull were lost. It's somehow inconvenient to return something like this to the grave. Perhaps it is worth organizing a new burial,” admitted a source in the Ministry of Defense. Secondly, Andrei Belousov opposes the burial of the commander's ashes. In particular, he wants to start the practice of mandatory group prayers at the front ( we wrote about such plans ) with meetings near the remains of Suvorov. And he believes that the ashes of Alexander Vasilyevich will help if the Minister of Defense nevertheless decides to go to the zone of the North Military District.

“Andrei Removich is now thinking about a trip to the front ( we reported about this - ed.). And he believes that the ashes of Alexander Vasilyevich Suvorov will save him. And Andrei Removich has not yet been able to pray near this relic. There's not enough time,” an interlocutor close to the defense minister told us. Let us note that in the matter of burying Suvorov’s ashes, Belousov’s word now means more than Shoigu’s.

https://t.me/kremlin_secrets/4239

Magical thinking...

6,579 posted on 06/15/2024 9:59:40 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT “Due to the introduction of restrictive measures by the United States again)
[ Post Reply | Private Reply | To 6481 | View Replies]

The Chinese Yuan will become the main foreign currency of Russia, the Central Bank of the Russian Federation announced. The Yuan/Ruble exchange rate will now set the trajectory for all other currency pairs, including the Euro and Dollar.

Russian Embassy in South Africa

https://x.com/EmbassyofRussia/status/1801577557281624367


6,580 posted on 06/15/2024 10:12:36 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT “Due to the introduction of restrictive measures by the United States again)
[ Post Reply | Private Reply | To 6579 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 6,541-6,5606,561-6,5806,581-6,600 ... 6,661-6,676 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson