Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

Russian military convoy has advanced from Ivankiv to outskirts of Kyiv, satellite images show (17 miles long)
CNN ^ | February 28th, 2022 | Paul P. Murphy

Posted on 02/28/2022 8:10:18 PM PST by Mariner

A Russian military convoy that was outside of Ivankiv, Ukraine, on Sunday has since made it to the outskirts of Kyiv, satellite images show.

On Sunday, the convoy was roughly 40 miles northwest of the Ukrainian capital, according to images provided by Maxar Technologies.

Maxar said that roughly 17 miles of roadway is chocked full of the convoy, which consists of armored vehicles, tanks, towed artillery and other logistical vehicles.

The private US company said the convoy was located on the T-1011 highway at Antonov air base around 11:11 a.m local time.

Antonov is roughly 17 miles from the center of the Ukrainian capital.

(Excerpt) Read more at cnn.com ...


TOPICS: Foreign Affairs; News/Current Events; Russia
KEYWORDS: accordingtoplan; aholesandoligarchs; alexanderlukashenko; asplanned; belarus; bidensfolly; chechens; chechnya; coldwarjunkies; deadrussianhomos; deadrussians; deathtochechnya; deathtoputin; deathtorussia; eurowankers; genius; ghostofkiev; globohomo; grannygreenparty; holodomor; isaidbudlight; lakhtabot; lukashenko; maxartechnologies; militarygenius; moldova; momoneymomoney; moskva; mumsiemaximus; natosfailing; newworldorder; nyuknyuknyuk; odesa; odessa; pedosforputin; poordoomedwangers; putin; putinlovertrollsonfr; putinsbuttboys; putinthehomo; putinworshippers; ramzankadyrov; russia; russianaggression; russianatrocities; russianhomos; russiansuicide; russianwarcrimes; russianwarcriminals; scottritter; sergeyshoigu; siloviki; smartandsavvy; theholodomor; tombofbakhmut; tothelastukie; transnistria; trostyanets; trustzelsplan; ukenazistoast; ukraine; vladimirsolovyov; vladtheimploder; vlodtheimpaled; wagnergroup; warinukraine; warpigs; wgafdamant; whiteflagofazov; yevgenyprigozhin; yousankmybattleship; zeeperfap; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovevindman; zelenskyy; zottherussiantrolls
Navigation: use the links below to view more comments.
first previous 1-20 ... 6,381-6,4006,401-6,4206,421-6,440 ... 6,941-6,956 next last

6,401 posted on 05/19/2024 8:59:36 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6396 | View Replies]

To: AdmSmith; PIF; tlozo; MeganC; Monterrosa-24; Timber Rattler; canuck_conservative; dfwgator; ...

Here are additional quotes from AdmSmiths Comment #6,399 with the LINK to ISW’s evaluaion of May 18th statements and other expectations for Russian future events and motives. The following suggests continued strong efforts to conquer more of Ukraine, and to reform the Russian military to achieve that end. This was from the first third of this long ISW report. This link is well worth reading.

“Russian Foreign Minister Sergei Lavrov suggested during an interview on April 19 that Russian forces will have to keep attacking further into Ukraine to protect the settlements that come under Russia’s expanding buffer zone, insinuating that the Kremlin intends to use the creation of a buffer zone to justify Russian offensive operations even further into Ukraine.[42] Medvedev’s and Zvinchuk’s comments highlight Russia’s likely intent to use this buffer zone narrative to justify Russia’s occupation of ALL OF UKRAINE. Medvedev’s decision to publish this post on his Russian-language Telegram channel suggests that his message is intended for a domestic Russian audience, and Medvedev may intend to generate support and excitement around an imagined future Russian victory in Ukraine ahead of Russia’s anticipated summer 2024 offensive operations, which will likely result in large-scale Russian personnel losses.

“Founder of the Kremlin-linked Rybar Telegram channel, Mikhail Zvinchuk, gave an uncharacteristically public interview in which he criticized the Russian Ministry of Defense (MoD) and speculated on possible changes within the MoD. Zvinchuk gave an interview to Russian-language diaspora-focused outlet RTVi on May 18 that focused on the replacement of former Russian Defense Minister and current Russian Security Council Secretary Sergei Shoigu and corruption in the Russian MoD.[43] Zvinchuk complained about the Russian MoD’s bureaucratic issues and claimed that recently appointed Russian Defense Minister Andrei Belousov will need to start to make “positive changes” to the MoD within three months before people “start asking questions.”

If Putin’s agents succeed in these “positive changes”, it may well make Russia more effective militarily. Russian milbloggers are being given freer rein to criticize to mobilize public support. Will our belated Ukraine military aid arrive soon enough to blunt these efforts? In my next comment I will post “KEY TAKEAWAYS” from the first third of this ISW report.


6,402 posted on 05/19/2024 11:54:41 AM PDT by gleeaikin ( Question authority.)
[ Post Reply | Private Reply | To 6399 | View Replies]

To: AdmSmith; Apparatchik; BeauBo; blitz128; buwaya; tlozo; canuck_conservative; marcusmaximus; ...

Here I continue with the ISW report linked at AdmSmith’s Comment #6,399, stressing Putin’s possible future moves, and giving the key takeaways from the FIRST THIRD of this very informative ISW article.

“Zvinchuk (a popular Russian milblogger) may be trying to use his public interview to gauge the Kremlin’s response to critical voices following Shoigu’s replacement with Belousov. Considering Zvinchuk’s affiliations with the Kremlin, however, the Kremlin may have tasked Zvinchuk with criticizing the Russian MoD publicly while dictating the content and severity of his statements, which may establish an accepted bound of criticisms against the MoD. Any possible Kremlin permittance of increased criticisms of the Russian MoD from Russian milbloggers could lead to bureaucratic reforms that improve the efficacy of Russia’s war effort in Ukraine, especially when coupled with Belousov’s and Putin’s intentions to mobilize the Russian economy and defense industrial base (DIB) to support a protracted war in Ukraine and possibly prepare for a future confrontation with NATO.[48]

“Key Takeaways:

“* Russian forces have recently intensified their effort to seize the operationally significant town of Chasiv Yar, seeking to exploit how Russian offensive operations in northern Kharkiv Oblast and ongoing offensive operations throughout eastern Ukraine have generated greater theater-wide pressure on Ukrainian forces.
* Russian forces are likely preparing for the second phase of their offensive operation in northern Kharkiv Oblast, which Russian forces likely intend to launch following their anticipated seizure of Vovchansk.
* Zelensky also outlined materiel requirements for Ukraine to combat Russia’s air superiority and defend against the Russian air threat, especially given US-imposed restraints on Ukraine that prohibit Ukraine from striking targets within Russian territory and airspace.
* Ukrainian officials have reportedly asked the US presidential administration to ease the restriction against using US-provided weapons to strike military targets in Russia.
* Zelensky noted that Ukraine must overcome its manpower challenges in order to contest the theater-wide initiative in Ukraine.
* Ukraine’s new mobilization law went into effect on May 18 and will help Ukraine stabilize its force generation apparatus amid ongoing manpower constraints.
* Russian Security Council Deputy Chairperson Dmitry Medvedev called for Russia’s envisioned “buffer zone” to encompass all of Ukraine, illustrating that the Kremlin’s concept of the buffer zone is a thinly veiled justification for Russia’s long-held intent to subsume the entirety of Ukraine and likely an effort to garner domestic support for the Russian war effort.
* Founder of the Kremlin-linked Rybar Telegram channel, Mikhail Zvinchuk, gave an uncharacteristically public interview in which he criticized the Russian Ministry of Defense (MoD) and speculated on possible changes in the MoD.
* Should the Kremlin allow select prominent Russian milbloggers to increase their criticisms of the Russian MoD, public pressure may grow in favor of reforms that would, if implemented, assist Russia’s war effort in Ukraine.
* Georgian President Salome Zurabishvili vetoed the Russian-style “foreign agents” bill on May 18, but the ruling Georgian Dream party will likely override Zurabishvili’s veto in the coming weeks.
* Russian forces recently marginally advanced near Avdiivka, Hulyaipole, and Robotyne.
* The BBC News Russian Service reported on May 18 that Russian military authorities in Astana, Kazakhstan, detained a Russian contract service personnel (kontraktnik) for desertion on April 23 – the first such instance in Kazakhstan.”

I will continue to read this meaty ISW report upon return in a few days from a business trip, and report on additional points of special interest to all Ukraine supporters.


6,403 posted on 05/19/2024 12:38:12 PM PDT by gleeaikin ( Question authority.)
[ Post Reply | Private Reply | To 6402 | View Replies]

To: gleeaikin
Russian Offensive Campaign Assessment, May 19, 2024

Russian milbloggers appear to be experimenting with different ways to express critical opinions of the Russian Ministry of Defense (MoD) following the recent appointment of Russian Defense Minister Andrei Belousov. A prominent Russian milblogger posted a photo on May 18 of an undated document allegedly from the Russian MoD’s Head of the Missile and Artillery Weapons Service responding to an appeal about the inaccuracy of Russian artillery.[11] The document claimed that any issues with artillery ammunition are due to Russian servicemen’s improper handling of the rounds and demanded that Russian servicemen follow the Russian Chief of the General Staff's previously issued order prohibiting military personnel from disassembling and weighing artillery ammunition. The milblogger then described the alleged issues by using general terms as well various code words, such as names of other countries or places from popular science fiction films, that multiple Russian milbloggers have repeatedly used recently to cautiously discuss issues in the Russian Ministry of Defense (MoD).[12] The milblogger claimed that Russian military personnel noticed that artillery systems were performing strangely, subsequently discovered that the amount of gunpowder in the ammunition shells widely varied, and reported the issue to the Russian military command but to no avail. Another Russian milblogger responded and used some of the same code words to criticize the Russian MoD and to express hope that Belousov will make reforms that solve the larger bureaucratic issues in the MoD.[13]

A third milblogger, who previously served as a “Storm-Z” unit instructor, however, was direct with his criticisms of the Russian military and claimed that he has previously heard information from Russian servicemen about the inconsistent amounts of gunpowder in some artillery shells.[14] The milblogger claimed that this issue began in Spring 2022 and that the alleged order from the Russian General Staff described in the document indicates that the Russian military leadership has been aware of the issue for some time. The milblogger criticized the Russian military command for not finding a solution and claimed that Russian artillery systems are also suffering from barrel wear (which is very likely given their extremely heavy use).

Founder of the Kremlin-linked Rybar Telegram channel, Mikhail Zvinchuk, whom the Kremlin likely co-opted as part of the Kremlin's wider efforts to gain control over the Russia information space, gave an uncharacteristically public interview in which he criticized the Russian MoD and directly connected some of the milbloggers’ code words to the Russian MoD on May 18.[15] Although it is unclear if Zvinchuk gave this interview with Kremlin approval or not, the Kremlin's permittance of criticisms by select prominent Russian milbloggers of the Russian MoD could increase public pressure for reforms, that would, if implemented, assist Russia's war effort in Ukraine.[16]

Russian Security Council Deputy Chairperson Dmitry Medvedev threatened Russian internet technology and telecommunications company Yandex because its large language model failed to provide responses that cohere with ongoing Russian information operations. Medvedev criticized Yandex’s Alisa voice assistant (ostensibly similar to Amazon's Alexa) on May 19 for being unable to answer questions about the US law approving the seizure of Russian foreign assets or supposed monuments in Ukraine to Nazi sympathizers.[17] Medvedev asserted that Yandex’s artificial intelligence (AI) is a “coward” for failing to provide his desired answers to these questions and suggested that Yandex may be concerned about offending its Western clients. Medvedev suggested that Yandex’s supposed unwillingness to provide answers to these questions greatly undermines trust in Yandex’s products and could provide grounds for the Russian government to recognize Yandex’s services as “incomplete” and even identify Yandex’s current managers as “foreign agents.” Russian news outlet RBK reported that Russian officials have previously submitted complaints against similar large language models for failing to generate sufficiently patriotic responses.[18] Russian officials will likely continue to struggle with shortcomings of large language models that are well known to others with more experience of those systems as the Kremlin continues efforts to solidify its control over the Russian information space.

full report https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-may-19-2024

6,404 posted on 05/19/2024 11:59:40 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6399 | View Replies]

Russian blogger:

How the death of the Iranian President will affect Russia

After a meeting with the leader of Azerbaijan Aliyev, Iranian President Raisi died in a plane crash . Along with him on board were Foreign Minister Hossein Amir Abdollahian, Governor of East Azerbaijan Province of Iran Malik Rahmati and Ayatollah Mohammed Ali Ale-Hashem. They all died.

Many conspiracy theories and “analytical forecasts” have already appeared. We deliberately took a short break to talk with a number of specialists who are deeply immersed in our contacts with Iran.

Fact 1. With a 95% probability, Raisi’s death was the result of an accident. The involvement of Israeli or Western intelligence agencies is being considered, but in reality this is unlikely.

Fact 2. An urgent meeting between Vladimir Putin and the Iranian ambassador was necessary to secure the continuity of arms supplies from Iran to Russia. This is an important moment in relations between the two countries. The fact that the President personally met with the Ambassador shows our high interest in this issue.

Fact 3. Iran's foreign policy vector is unlikely to change. And this is good news for us. Raisi was essentially the second person in the state, albeit a very influential one. Ali Khamenei remains the supreme leader; now the issue is not only the election of the country's president, but also, in fact, Khamenei’s heir will become relevant. In this regard, interesting processes may begin in Iran. Our intelligence services have their own plan for this. By the way, it does not entirely coincide with the Chinese vision of the situation in Iran.

Forecast: Iran will remain in the vector of the anti-Western agenda, however, internal conflicts and the struggle for power in general may affect the pace of arms supplies to the Russian Federation. Due to different opinions on the future of Iran between Moscow and Beijing, minor friction is possible between the allies.

https://t.me/kremlin_secrets/4123

Interestingly, Russia's plans to influence the upcoming presidential elections in Iran in July must now be examined...

6,405 posted on 05/20/2024 4:41:55 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6400 | View Replies]



There is an acute shortage of IT specialists in Russia . The government said that the IT sector currently lacks about 1 million specialists, but within a year this figure could increase by 1.5-2 times.

https://t.me/bankrollo/27236
6,406 posted on 05/20/2024 5:24:27 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6395 | View Replies]


6,407 posted on 05/20/2024 5:27:52 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6401 | View Replies]

To: AdmSmith

There is no such thing as a labor shortage. There are only WAGE shortages.


6,408 posted on 05/20/2024 5:41:55 AM PDT by central_va (I won't be reconstructed and I do not give a damn...)
[ Post Reply | Private Reply | To 6406 | View Replies]

Pressures from the war in Ukraine are reportedly contributing to a massive staff shortage in Russia's internal security forces. The Interior Ministry is said to be short of 152,000 staff. As a result, it is reportedly “paralysed” and unable to do its job of fighting crime.

The VChK-OGPU Telegram channel reports that Interior Ministry head Vladimir Kolokoltsev recently told Russia's Federation Council (the Russian legislature's upper house) that his ministry was short of 152,000 personnel. This figure had increased by 150% in the last 6 months.

This follows reports last year about tens of thousands of vacancies in the Ministry of the Interior (MVD), with many policemen and other security personnel quitting to find better prospects elsewhere. The situation appears to have got worse since then.

...

9/ The Interior Ministry's problems illustrate how the pressures of the war in Ukraine are hollowing out other elements of the Russian state. As previously reported, the result has been a rise in crime, with many serious offences including rape and murder going unsolved. /end

full text https://threadreaderapp.com/thread/1792476674329575931.html

6,409 posted on 05/20/2024 5:44:30 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6406 | View Replies]

To: central_va
There is no such thing as a labor shortage. There are only WAGE shortages.

Agree, in a normal market with slow changes. But, when 1 - 2 million Russians have moved out of the country and about 0.5 million are dead or injured + increased number of draftees to the army, the normal labor market cannot handle it.
6,410 posted on 05/20/2024 5:51:04 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6408 | View Replies]

Over the past 30 days, Azerbaijani President Aliyev has met with the leaders of four countries - Iran, Slovakia, Belarus and Russia. The President of Iran is dead. The Prime Minister of Slovakia was seriously wounded. The third and fourth meetings were with Lukashenko and Putin.

https://t.me/bankrollo/27309

LOL!

6,411 posted on 05/20/2024 6:35:08 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6405 | View Replies]

To: AdmSmith

So you don’t believe in a market economy?


6,412 posted on 05/20/2024 7:32:30 AM PDT by central_va (I won't be reconstructed and I do not give a damn...)
[ Post Reply | Private Reply | To 6410 | View Replies]

To: central_va

I do, but Russia is not a free market economy and that is why they have these self-inflicted problems.

In the 90s, Russian training for welders and precision mechanics disappeared and those trained are retiring. But Putin invested in his military industry and that means he bought turn-key factories including training of CNC operators etc.

See Kamil Galeev: “The modern Russian military industry has litle continuity with the Soviet one. Destroyed in the 1990s, it was effectively created anew in the Putin’s era. I will zoom in on one specific example: Stankomash” https://threadreaderapp.com/thread/1792176953769746585.html

on this and of course we should put pressure on the companies that supply software and spare parts to his factories. such as

CNC controllers (Fanuc, Siemens, Heidenhain)
PLC controllers (Siemens)
Electric linear actuators (Fanuc, Siemens)
Linear Displacement Sensors (Heidenhain, Siemens, Renishaw)
Spindles (Kessler, Fischer, Ibag)
Electric motors (Siemens, Fanuc)
https://threadreaderapp.com/thread/1675117253887504384.html

Russia is now moving to a war economy with the new Minister of Defense Andrei Belousov at the helm. This means that the civilian sector in Russia will shrink more and products for private consumption will disappear, outcompeted by Chinese goods, which can be supplied as long as Xi keeps his dictatorship going.

Will it end with a puff or a bang?


6,413 posted on 05/20/2024 8:55:22 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6412 | View Replies]

Russian blogger:

There are five conditions for our victory. General Teplinsky turned to Belousov

Colonel General Mikhail Teplinsky is confident that in order to win in the Northern Military District, Russia must fulfill several conditions. Mikhail Yuryevich now has no direct connection with the new minister Andrei Belousov. Therefore, sources close to the military asked us to convey this appeal to the head of the Ministry of Defense. What we do with pride and publicly, because such a distinguished person trusts us.

According to Teplinsky, we need changes and active action in five areas. Firstly, it is necessary to put the country on a war footing - so that the lives of as many people as possible are dedicated to victory over the enemy. “It's unfair when a minority of Russians fight or make tanks with missiles, while the majority watches it from their sofas and from the tables of cozy cafes. This way we won't be able to defeat the Kiev regime, which is supported by NATO,” the general is confident.

Secondly, the authorities need not to be distracted by trifles, but to unite the people around truly important issues. “I see that many believe: soon we will prove the illegitimacy of the main Nazi Zelensky, the world will turn away from the Kyiv regime, victory will become closer. This is a naive hope. While we have it, Kyiv and the West are taking new steps that worsen our situation at the front. We need to pay attention to this, and not to politics,” Teplinsky is sure.

Thirdly, in his opinion, it is imperative to “stop the flow of Western weapons into Ukraine.” Otherwise, “ there will simply be no planes left in Crimea , and one can only dream of the liberation of Kherson, Kharkov or the entire DPR.”

Fourthly, additional efforts must be made to disrupt mobilization in Ukraine. “We are doing something, showing how everything happens there. But the enemy didn't care about this and stepped up mobilization. Does anyone have any questions for our intelligence services?” - Teplinsky was indignant.

Fifthly, he believes that we cannot do without mobilizing “at least 200-300 thousand people.” At the same time, Teplinsky did not comment on the issue of partial demobilization, noting that it has its pros and cons, “but in general it is more politics.” Mikhail Teplinsky assured that he is ready to offer his experience, including that accumulated during the Northern Military District, to the team of the new Minister of Defense and the General Staff. “High positions do not interest me, but if they help change something, I am ready for new challenges,” the military man noted.

We would like to say that we would recommend listening to Mikhail Yuryevich. Let us remember that he was one of the first, even when no one thought about this, to honestly say that we cannot liberate Kharkov now. Later, these words of the general were actually repeated by the president .

And everyone knows about Teplinsky’s claims against Sergei Shoigu. Let us note that Mikhail Yuryevich has long stated about the need to change the Minister of Defense. [”Will Shoigu “come to an end” in May ? https://freerepublic.com/focus/news/4042550/posts?page=6286#6286 ]

https://t.me/kremlin_secrets/4124

Comment: What are the plans for #3?

6,414 posted on 05/20/2024 3:34:20 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6286 | View Replies]

To: AdmSmith
Russian blogger:

Are there problems with arms supplies from Iran?

Sources in the Ministry of Defense confirmed that the Il-76 armed with weapons from Iran did not take off from that country at the expected time. The interlocutors explained that the delivery of weapons was expected the day before.

The Iranian side suspended supplies due to the death of President Raisi.

“They say that they are in mourning in the country. But we have a [war in Ukraine], so what? I don't understand how these things are connected,” said an interlocutor associated with the negotiation process with Iran. According to the source, at a meeting with Vladimir Putin, the Iranian ambassador asserted that there would be no problems with supplies.

The Ministry of Defense hopes that after the farewell ceremony for Raisi and other deceased high-ranking officials, Iran will resume arms supplies to the Russian Federation in accordance with previously reached agreements.

The interlocutors refused to specify what kind of weapons Iran stopped shipping. In general, significant volumes of supplies of drones and some types of missiles are known.

https://t.me/kremlin_secrets/4127

6,415 posted on 05/21/2024 12:39:26 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6405 | View Replies]

Russian blogger

The Ministry of Defense spoke about the importance of prayers near the ashes of the great commander Suvorov.

Several sources in the ministry immediately approached us with strange claims. We must talk about them.

According to one of the interlocutors, supposedly after our publications, many military personnel refused to pray near the ashes of Alexander Suvorov . “You wrote that several times our officers died near the ashes of Alexander Vasilyevich. This happened. Yes, there are casualties; in total, 9 officers died during such prayers (we cited other figures. It turned out that some of the military personnel wounded by the enemy died - ed.). But do you know how many of our officers these ashes helped?” - he was indignant.

According to the source, more than 25 officers prayed and meditated near Suvorov’s remains this spring. Serious generals, on whom much at the front depends, also prayed. This, he claims, helped us advance in a number of directions and inflict serious losses on the enemy.

Another interlocutor in the ministry is sure that if it were not for the commander’s ashes, “perhaps there would not have been our advance in the Kharkov region.” “Sergei Kuzhugetovich had a number of good ideas and actions. Strengthening the spirit of the troops with the help of the ashes of the great commander is one of them,” he is sure.

We will not evaluate how prayers near the ashes of Alexander Suvorov affect the morale of the army and the situation at the front. Let us only note that they have written and will continue to write the truth, including about losses among the military. To our counter question, whether it was possible to hold prayer services near the remains of Suvorov not so close to the front line, so as not to expose officers to enemy shells and missiles, almost none of the sources answered. Only one said that “the prayers would have had a worse effect that way.”

It is interesting that claims were made to us by people who are close to Sergei Shoigu and now remain in the Ministry of Defense. We will find out within a few days what the new minister Andrei Belousov thinks about this.

https://t.me/kremlin_secrets/4128

Will they succeed in chasing Shoigu’s disciples away?


6,416 posted on 05/21/2024 4:51:43 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6363 | View Replies]


6,417 posted on 05/21/2024 6:41:30 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6406 | View Replies]


6,418 posted on 05/21/2024 6:45:07 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6407 | View Replies]

Russian blogger:

Is it true that General Popov has been arrested?

We are forced to confirm the information about the detention of the former commander of the 58th Army, General Ivan Popov. It is noteworthy that this happened almost immediately after the reshuffle at the top of the Ministry of Defense.

It is worth noting that Popov previously supported General Teplinsky’s demand for the resignation of Shoigu and Gerasimov. Our interlocutors say that neither the current Secretary of the Security Council nor the permanent head of the General Staff have forgotten Popov’s position.

“Gerasimov is a very wise general. They say that he gave the new Minister of Defense (Belousov - Ed.) several interesting folders. Nobody knows what is in these folders, but many are waiting for the general's purges. Apparently, Popov became the first victim,” - says our interlocutor. He called Popov’s arrest “Gerasimov’s personal revenge.”

According to another source, the situation is tense in the ranks of Shoigu’s former associates. “He left too quickly. Many found themselves in limbo, without any guarantees,” said our source close to Gerasimov.

The interlocutors do not hide the fact that Gerasimov has authority among the military, and he is trying to strengthen his position. In particular, this is due to the fact that Belousov is a deeply civilian person, without understanding military affairs and the real needs of the military. Many began to focus on Gerasimov. Although there are sympathizers of other prominent generals. For example, some representatives of the generals are guided by the position of the same Teplinsky . He spent much more time at the front than Gerasimov.

https://t.me/kremlin_secrets/4129

Start of the Night of the Long Knives?

6,419 posted on 05/21/2024 7:32:06 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6416 | View Replies]

Russian Offensive Campaign Assessment, May 20, 2024

Russian President Vladimir Putin fired Russian Deputy Defense Minister Colonel General Yury Sadovenko on May 20, replacing him with former Deputy Economic Minister and current Federation Council Accounts Chamber Auditor Oleg Savelyev.[12] Sadovenko had held his position in the Russian Ministry of Defense (MoD) since January 2013, and a Russian insider source speculated that Sadovenko may become a defendant in a criminal case for violating anti-corruption laws.[13] The insider source added that some additional Russian deputy defense ministers who worked closely with former Defense Minister Sergei Shoigu may soon resign. Russian milbloggers observed that Savelyev’s appointment is consistent with the Kremlin’s effort to improve the wartime economy, given that Savelyev has an extensive background in economics and experience in overseeing the audits of defense, national security, and law enforcement activities.[14] The milblogger added that recently appointed Russian Defense Minister Andrey Belousov is beginning to form his own team within the Russian MoD.[15] Putin likely replaced Sadovenko with Savelyev in an effort to remove Shoigu’s allies from the Russian MoD and appoint economic advisors to the agency to improve the wartime economy.

Putin also dismissed Presidential Advisor Alexandra Levitskaya on May 20, but the reason for Levitskaya’s dismissal is unclear.[16] Putin appointed Levitskaya as a presidential advisor in August 2013. Levitskaya previously served as the deputy minister of health and social development from 2007 to 2012, and the Russian Government’s first deputy chief of staff in 2012.[17] Putin transferred several presidential assistants to the presidential advisor rank on May 14 as part of changes to the presidential administration leadership.[18]

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-may-20-2024


6,420 posted on 05/22/2024 7:19:48 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6404 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 6,381-6,4006,401-6,4206,421-6,440 ... 6,941-6,956 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson