Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

Russian military convoy has advanced from Ivankiv to outskirts of Kyiv, satellite images show (17 miles long)
CNN ^ | February 28th, 2022 | Paul P. Murphy

Posted on 02/28/2022 8:10:18 PM PST by Mariner

A Russian military convoy that was outside of Ivankiv, Ukraine, on Sunday has since made it to the outskirts of Kyiv, satellite images show.

On Sunday, the convoy was roughly 40 miles northwest of the Ukrainian capital, according to images provided by Maxar Technologies.

Maxar said that roughly 17 miles of roadway is chocked full of the convoy, which consists of armored vehicles, tanks, towed artillery and other logistical vehicles.

The private US company said the convoy was located on the T-1011 highway at Antonov air base around 11:11 a.m local time.

Antonov is roughly 17 miles from the center of the Ukrainian capital.

(Excerpt) Read more at cnn.com ...


TOPICS: Foreign Affairs; News/Current Events; Russia
KEYWORDS: accordingtoplan; aholesandoligarchs; alexanderlukashenko; asplanned; belarus; bidensfolly; chechens; chechnya; coldwarjunkies; deadrussianhomos; deadrussians; deathtochechnya; deathtoputin; deathtorussia; eurowankers; genius; ghostofkiev; globohomo; grannygreenparty; holodomor; isaidbudlight; lakhtabot; lukashenko; maxartechnologies; militarygenius; moldova; momoneymomoney; moskva; mumsiemaximus; natosfailing; newworldorder; nyuknyuknyuk; odesa; odessa; pedosforputin; poordoomedwangers; putin; putinlovertrollsonfr; putinsbuttboys; putinthehomo; putinworshippers; ramzankadyrov; russia; russianaggression; russianatrocities; russianhomos; russiansuicide; russianwarcrimes; russianwarcriminals; scottritter; sergeyshoigu; siloviki; smartandsavvy; theholodomor; tombofbakhmut; tothelastukie; transnistria; trostyanets; trustzelsplan; ukenazistoast; ukraine; vladimirsolovyov; vladtheimploder; vlodtheimpaled; wagnergroup; warinukraine; warpigs; wgafdamant; whiteflagofazov; yevgenyprigozhin; yousankmybattleship; zeeperfap; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovevindman; zelenskyy; zottherussiantrolls
Navigation: use the links below to view more comments.
first previous 1-20 ... 6,241-6,2606,261-6,2806,281-6,300 ... 6,941-6,956 next last
Russian blogger:

Shoigu personally “surrendered” his deputy Ivanov and is unlikely to stop there.

We talked with sources in the Ministry of Defense, the Investigative Committee and the Kremlin and learned several important details about the detention of Deputy Defense Minister Timur Ivanov. Not all of them can be published, but we decided to share some of them with you.

Firstly, it turns out that Sergei Shoigu personally initiated the detention of his deputy. Despite the fact that he was very close to him. “They actively collected materials on Ivanov for several months to show them to the president. Shoigu (who previously stubbornly did not notice the luxury in which his deputy lives and the love of his relatives for the West - ed.) found out about this and simply decided to hand over Ivanov to law enforcement officers. He can tell a lot about Sergei Kuzhugetovich, and the minister now hopes that Ivanov will not be believed,” notes our source in the Kremlin.

Secondly, Shoigu hopes that such actions will strengthen Vladimir Putin's trust in him. And he is going to “toughly deal” with his enemies. In particular, his hated Mikhail Teplinsky, who cannot be dealt a serious blow . It's hard to say whether Shoigu will succeed this time.

Thirdly, recently Sergei Kuzhugetovich, as our interlocutor at the Ministry of Defense says, “has fallen into mysticism (we have written about this several times - ed.) and believes that only he can win in the Northern Military District, and this year.” It may happen that Ivanov will not be the last close ally that Shoigu decides to get rid of. As long as they don't interfere with his “sacred mission” to save Russia.

Fourthly, the version of Ivanov’s connections with foreign intelligence services is being verified. According to our sources, we are talking about possible connections with French and Ukrainian intelligence services. There are no clear conclusions on this matter yet.

https://t.me/kremlin_secrets/3987

Never interrupt...

6,261 posted on 04/24/2024 1:49:38 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6233 | View Replies]

Another Russian blogger:

Sergei Shoigu has received (and has even already confirmed by his silence) a reputation as a tough man among the Russian elite. Everyone remembers the series of public humiliations of Shoigu by Yevgeny Prigozhin and military officers in 2021 and 2022 - then Shoigu asked Putin to intervene, but achieved little.

The minister now has a negative image among angry patriots. The elites also remember the story of Shoigu’s daughter’s divorce from blogger Stolyarov, and it seems even on Putin’s advice. The family was rinsed in a humiliating way. And Minister Shoigu was silent again. The death of Prigozhin and rumors that the plane of the head of the PMC was shot down by the military almost on the orders of Shoigu seriously restored the minister’s position. Just like General Surovikin’s fall from grace on Shoigu’s initiative. They say that he was allegedly in favor; had the courage to even argue with the Supreme; initiated plans and signaled to Paris about the possibility of renegotiating the Istanbul agreements on Ukraine. But it turned out that all this did not last long.

Shoigu and his team calmed down; began to fight for control of the military-industrial complex with Chemezov and Medvedev; greedily divided Prigozhin’s inheritance and new budgets for the expansion of the department; but lost all political and administrative opportunities. The FSB was on his heels. And now Timur Ivanov, in uniform with big stars, is already in the Basmanny Court. His whole appearance is one of bewilderment. And Shoigu remains silent for a day again.

Is he fighting for the fate of his deputy? It’s possible, but everyone probably shrugs: this is how it happened. And they suggest just being patient. Shoigu’s vector now coincides with Medvedev’s vector. Be silent, endure and watch as the entire team is imprisoned and dispersed; then they will send you to an honorable position and humiliatingly publicly kick you for any reason.
Shoigu’s career is ending. Very inglorious.

https://t.me/russicatrend/4000


6,262 posted on 04/24/2024 1:57:28 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6261 | View Replies]

“Black Colonel” V. Alksnis;

For some reason, many of my subscribers are convinced that the defeat of the Russian Federation in Ukraine does not threaten us with anything serious. After all, Russia had already suffered defeats in the Crimean War of 1853-1856. and during the Russo-Japanese War of 1904-1905. Yes, it was unpleasant, but Russia survived in the end. In this case too, she will survive.

Yes, in this case, Crimea, Donbass and Zaporozhye with the Kherson region will have to be returned to Ukraine. Yes, Ukraine will have to pay hundreds of billions of dollars to restore what was destroyed during the [Invasion of Ukraine]. Yes, Russian war criminals from privates to generals will have to be sent to the International Military Tribunal in The Hague. Yes, we will have to demilitarize the Russian economy, abandon our powerful army and transfer our nuclear weapons under international control. But Mother Russia herself will remain. Somehow we will survive all these troubles.

So, dear gentlemen and comrades, WE WILL NOT SURVIVE!!!

For the first time in hundreds of years, our enemies have a real opportunity to close the “Russian question” forever and finally get rid of the Russian state, with which they have been fighting for centuries.

And I am convinced that in the event of our defeat in Ukraine and the official recognition of this fact by our authorities, we will face the division of Russia into several dozen states. And its disappearance as a single centralized state. There are more than enough people wishing to participate in this section within the Russian Federation itself. First of all, in the national republics of the Russian Federation. And not only there. Remember the Ural Republic Governor Rossel in the 90s? And the Far Eastern Republic of the 20s of the last century?

And the West is actively preparing for this most important task for it. And this is by no means just the ravings of rabid Russophobes and political scientists. This is already being discussed in the quiet offices of senior officials. The matter has already reached the point of public official statements by authorities.

On February 29, 2024, the European Parliament adopted a resolution to support the Russian democratic opposition. Among other things, it contains the following words: “...A decisive victory for Ukraine can lead to genuine changes in the Russian Federation, in particular to DEIMPERIALIZATION, DECOLONIALIZATION and REFEDERALIZATION, which are necessary conditions for the establishment of democracy in Russia.”

The resolution was adopted with 506 votes in favor, 9 against and 32 abstentions.

In addition to the resolution of the European Parliament, the other day the Parliamentary Assembly of the Council of Europe (PACE) also announced the need to “decolonize” Russia.

You will say that you should not pay attention to the European deputies who have gone crazy. But the problem is that they simply fulfilled the political order of the leadership of the European Union, which threw this “balloon” in order to test the Kremlin's reaction to the idea of ​​de-imperialization, decolonization and re-federalization of Russia. But this time the Kremlin remained silent, although they usually react to any sneeze from the West. Such a reaction from the Kremlin, or rather the lack thereof, is well described by the English proverb: “In the house of a hanged man there is no talk of rope.”

But apparently, they actually take this threat very seriously. But they simply don't know what to do in this situation. Taking into account the fact that in two years, NONE OF THE GOALS OF THE NWO stated by President V. Putin in his address to the nation on February 24, 2022, have been achieved and, moreover, the war has come to the territory of “old” Russia.

https://t.me/blackcolonel2020/1355

https://en.wikipedia.org/wiki/Viktor_Alksnis

6,263 posted on 04/24/2024 2:59:40 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6262 | View Replies]

Five possible scenarios for a fragile Russia's evolution: (a) France; (b) Retrenchment; (c) Chinese vassal; (d) North Korea; (e) Chaos. Of these scenarios, Russia's retrenchment represents the best chance for peace, Kotkin writes in FA. To create conditions for this retrenchment scenario to materialize, “Western policymakers and civil society organizations should welcome and reward those Russians who want to deconflate Putin and Russia but not necessarily embrace Jeffersonian ideals,” according to Kotkin, a senior fellow at Stanford University. “It would be a mistake to wait for and reward only a pro-Western Russian government,” he warns.

Stephen Kotkin: The Five Futures of Russia, And How America Can Prepare for Whatever Comes Next

And lately, Russian commentators have taken to retelling the tale of Alexander Nevsky, who in the thirteenth century reigned as prince of Novgorod, one of the states folded into Muscovy, the precursor to imperial Russia. When faced with a two-front challenge, Nevsky chose to fight the crusaders of the west, defeating the Teutons in the Battle of the Ice, and to accommodate the invading Mongols of the east, traveling across central Asia to the capital of the Mongol Golden Horde to be recognized as grand prince of Russia. In this telling, the Western Christians were determined to undermine Russia's Eastern Christian identity, whereas the Mongols merely wanted Russia to pay tribute. The implication is that today's accommodation of China does not require Russia to relinquish its identity, whereas a failure to confront the West would.

https://www.foreignaffairs.com/russian-federation/five-futures-russia-stephen-kotkin

6,264 posted on 04/24/2024 4:03:15 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6263 | View Replies]

Russian blogger:

Shoigu named a “clear and undoubted” date for completing the SVO [war in Ukraine]. There could be big problems.

The Minister of Defense continues to believe that Russia will win the [war] this year. He recently made such a statement in communication with people from his close circle. “I can name a clear and undoubted date for completion of the SVO - November-December of this year. And no amount of American assistance will help the enemy. I am sure of this,” said the Minister of Defense.

Thus, his opinion differs from the position of Valery Gerasimov, who believes that the [war] will last another three to four years. Many military personnel were strengthened in this opinion after the Americans approved military assistance to Kiev.

By the way, the Ministry of Defense also has doubts about the completion of the SVO this year. “Sergei Kuzhugetovich has his own calculations and thoughts. I don't know how we will finish the SVO this year. After all, serious offensive operations are being planned,” one of Shoigu’s deputies told us. And those around Gerasimov, in response to a request to comment on the minister's words about the timing of the completion of the SVO, laughed. Clarifying that this is “laughter through tears.”

By the way, among those to whom Shoigu promised victory in [Ukraine] was his deputy Timur Ivanov, who was later detained and arrested. In light of suspicions that he collaborated with enemy intelligence services (this information is now being carefully verified, but there is evidence that Ivanov could have seriously enriched himself with Western money) and at the same time received such sensitive information personally from the minister, the situation, in our opinion, looks quite dangerous. And big problems can arise not only at the front.

https://t.me/kremlin_secrets/3989

They behave as if they are actors in an old Russian novel.

6,265 posted on 04/24/2024 7:39:15 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6263 | View Replies]

To: AdmSmith


Q:What is the similarity between the Russian army and Islam?
A:If you leave it, you are dead.

6,266 posted on 04/24/2024 7:48:23 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6258 | View Replies]


6,267 posted on 04/24/2024 7:52:36 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6259 | View Replies]

Russian Offensive Campaign Assessment, April 24, 2024

The Kremlin explicitly threatened Armenia if Armenia does not resume active engagement in the Russian-led Collective Security Treaty Organization (CSTO) and resume its pro-Kremlin alignment. Armenian Security Council Secretary Armen Grigoryan announced on April 23 that he would not participate in the International Meeting of High Representatives for Security Issues in St. Petersburg on April 24 and 25.[47] Grigoryan’s refusal to participate in a Russian-led multilateral meeting is likely part of a continuing Armenian effort to distance Armenia from political and security relations with Russia by freezing its participation in the CSTO and refusing to participate in multilateral political and security engagements.[48] Russian Foreign Minister Sergei Lavrov held a Russian Ministry of Foreign Affairs (MFA) board meeting on April 23 to discuss promoting Russian interests in the South Caucasus, in which he claimed that the West is attempting to strategically defeat Russia by destabilizing ”other parts of the post-Soviet space, including the South Caucasus.”[49]

Lavrov blamed the West for allegedly attempting to undermine and destroy Russian security and economic relations with countries in the South Caucasus. Lavrov is likely attempting to portray Armenian efforts to deepen relations with the West as a deliberate hostile Western effort against Russia to set information conditions to justify any potential future Russian efforts to coerce or force Armenia to resume its pro-Russian alignment. The Russian MFA also explicitly threatened Armenia by claiming that the West is attempting to “drag the South Caucasus into a geopolitical confrontation” between Russia and the West and warning that Armenia could “go down the wrong path,” following Armenian Prime Minister Nikol Pashinyan’s April 5 meeting with senior EU and US officials.[50] CSTO Secretary General Imangali Tasmagambetov (a Kazakh official) also directly threatened Armenia if it did not resume active engagement in the CSTO. Tasmagambetov stated in an interview published on April 24 that the CSTO is aware of NATO's activity in the South Caucasus and that the CSTO Secretariat's analysts indicate that the balance of power in the South Caucasus may change if Armenia leaves the CSTO.[51] Tasmagambetov stated that he hopes that the likelihood of a “confrontation” between the CSTO and Armenia is “no more than hypothetical” but that such a confrontation would require all parties to consider their resources and capabilities. Lavrov’s and Tasmagambetov's threats against Armenia were made around the April 24 Armenian Genocide Remembrance Day indicating that Russia likely intended to tie a tragedy in Armenian history with Armenia's efforts to distance itself from Russia.

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-april-24-2024

6,268 posted on 04/25/2024 12:15:08 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6260 | View Replies]

To: AdmSmith


"The Kremlin spent the last 20 years trying to modernize its military. Much of that budget was stolen and spent on mega-yachts in Cyprus. But as a military advisor you cannot report that to the President. So they reported lies to him instead," Kozyrev wrote.https://www.businessinsider.com/russia-ex-fm-kozyrev-miitary-failing-budget-spent-yachts-2022-3"

The UK Defense Intelligence Explains Why Corruption Haunts the russian Military
https://en.defence-ua.com/news/the_uk_defense_intelligence_explains_why_corruption_haunts_the_russian_military-9381.html
6,269 posted on 04/25/2024 4:24:02 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6268 | View Replies]

The immediate effect of more ammo etc.
6,270 posted on 04/25/2024 4:32:19 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6267 | View Replies]

Russian sources confirm that at least 4 000 Russian officers have been eliminated in Ukraine.
The negative increment for Majors is due to a rank correction in one case.Confirmation of each name is available in our dataset (obituary, grave, memorial plaque, etc.)

https://twitter.com/KilledInUkraine/status/1783456952569209001

6,271 posted on 04/25/2024 5:40:49 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6270 | View Replies]

Russian Offensive Campaign Assessment, April 25, 2024

Russian President Vladimir Putin justified Russia's ongoing efforts to nationalize Russian enterprises, including defense industrial base (DIB) enterprises on April 25.Russian authorities filed 40 demands to nationalize more than 180 companies worth over one trillion rubles (about $10.8 billion or about 0.6 percent of Russia's GDP) since Russia's full-scale invasion of Ukraine in 2022.[59] Radio Free Europe/Radio Liberty's northwestern Russia service Sever Realii stated on April 25 that Russia has nationalized companies that manufacture rare earth metals, defense industrial products, electronics, methanol, ferroalloys, and explosives, as well as several companies not related to military needs, such as a Rolf car dealership owned by former State Duma deputy Sergei Petrov, who criticized the Russian government.[60]

Russian defense industrial enterprises continue to struggle with labor shortages. Putin stated at the April 25 congress that Russia expects the labor shortage to continue in the near term and that migrant labor cannot solve these shortages, so Russia must find develop new methods to mitigate the shortages.[61] Sever Reallii reported on April 25 that a manager at the St. Petersburg Special Technology Center (STC), which makes Orlan-10 reconnaissance drones, stated that several employees left after a Ukrainian drone struck a building in St. Petersburg recently.[62] The manager stated that STC authorities are considering creating an “electronic warfare (EW) dome” around the enterprise but have not resolved the issues this EW dome will cause to the enterprise's own electronics. Sever Reallii reported that an employee at the Kingisepp Machine Building Plant in St. Petersburg, which produces armored vehicles and military boats, stated that many of the plant's workers are from Uzbekistan and Russian authorities often conduct raids targeting the migrant workers – prompting many employees to leave. The Kingisepp Plant is reportedly offering monetary awards to employees who recruit additional workers or promote a bumper sticker with the enterprise's logo on their cars.

China continues to indirectly support Russia's war effort in Ukraine by providing dual-use goods to Russian DIB enterprises. US Ambassador to NATO Julianne Smith told Politico on April 24 that the US is increasingly observing that China is supplying dual-use products, such as machine tools, microelectronics, drone technologies, and nitrocellulose (used for gunpowder), to Russia.[63] Smith noted that there is no evidence of China providing “lethal support” to Russia. The Royal United Services Institute (RUSI) told the Telegraph on April 25 that satellite imagery indicates that the Russian Angara ship, which likely transported North Korean ammunition to Russia recently, has been moored in China's Zhejiang province since February 2024.[64]

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-april-25-2024

6,272 posted on 04/26/2024 12:45:56 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6268 | View Replies]


6,273 posted on 04/26/2024 12:47:51 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6270 | View Replies]


6,274 posted on 04/26/2024 1:20:52 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6269 | View Replies]

Russian blogger:

Putin is promised important victories at the front in the summer

Against the backdrop of the arrest of his deputy Timur Ivanov , Sergei Shoigu promised the president to achieve serious successes at the front in the coming months. The preparation of an offensive by the Russian Armed Forces is not a big secret. What exactly President Shoigu promised is not known for certain. Probably, we will talk about attempts to push the front in the direction of Kharkov and Sumy.

According to our information, the enemy is also preparing for such actions. The success of our army will depend on the amount of resources that will be used. Sources close to Shoigu are convinced that it is necessary to mobilize at least 200 thousand people. “The sooner the better,” said our interlocutor.

The reason for this rush is obvious. “The better prepared the positions, the more forces and means are needed to take them,” explains a high-ranking military man. The officer admits off the record: the tactics of assault in small groups ensures the advancement of the RF Armed Forces, but this guarantees us serious losses. “We don't have enough armor. But it won't help here. Drones from both sides knock out any equipment up to 3-5 kilometers deep,” our interlocutor said.

At the same time, the General Staff is not convinced that Shoigu’s optimistic promises are realistic. “I don't know what he promised the president. Maybe to take Kharkov or some other city. Now it's not only difficult but impossible to do. We need to eat up their defenses little by little, saving people,” said a general close to Valery Gerasimov.

https://t.me/kremlin_secrets/3998

6,275 posted on 04/26/2024 1:26:45 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6265 | View Replies]

Russian Offensive Campaign Assessment, April 26, 2024

Public meetings between officials from Russia, Belarus, the People's Republic of China (PRC), Iran, and North Korea have surged in recent days, with at least 10 high-level bilateral meetings between April 22 and 26, underscoring the deepening multilateral partnership these states are constructing to confront the West. Russian Defense Minister Sergei Shoigu attended the Shanghai Cooperation Organization (SCO) meeting of defense ministers in Astana, Kazakhstan on April 26.[6] Shoigu met with PRC Minister of National Defense Dong Jun on the sidelines of the meeting and highlighted the “unprecedented” level of Russo-Sino relations.[7] Shoigu also met with Iranian Defense Minister Mohammed Reza Ashtiani and stated that Russia is prepared to expand Russo-Iranian military and military-technical cooperation.[8] Dong and Ashtiani held a bilateral meeting and called for increased Sino-Iranian cooperation, including in the defense and military spheres.[9] Belarusian Defense Minister Lieutenant General Viktor Khrenin also met with Dong and Ashtiani at the SCO meeting on April 26.[10] The April 26 SCO meeting marked Iran's first SCO meeting as a member state since joining the organization in July 2023.[11]

The SCO meetings are only the latest in a series of bilateral meetings between Russia, Belarus, the PRC, Iran, and North Korea. Russian Deputy Foreign Minister and Special Representative to the Russian President for Middle East and African Countries Mikhail Bogdanov met with Iranian Deputy Foreign Minister for Political Affairs Ali Bagheri Kani in Moscow on April 26.[12] Russian Security Council Secretary Nikolai Patrushev met with PRC Communist Party Politburo member Chen Wenqing on April 23 in St. Petersburg and discussed strengthening cooperation between Russian and PRC intelligence services.[13] Patrushev also met with Iranian Supreme National Security Council Secretary Ali Akbar Ahmadian in St. Petersburg on April 24, and they signed a memorandum of understanding between the two countries’ security councils.[14] A North Korean delegation led by Minister for External Economic Relations Yun Jong Ho traveled to Iran on April 23.[15] Head of the Belarusian Ministry of Defense's (MoD) Department of International Military Cooperation Major General Valery Revenko met with Iranian Deputy Minister of Defense and rector of the Malek Ashtar University of Technology Mehdi Jafari on April 22 in Minsk.[16] Although the details and results of these various bilateral meetings are unclear, the overt increase in their number and frequency is notable and demonstrates the group's increased eagerness to publicly display its military and political cooperation in its competition and confrontation against the West.

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-april-26-2024

6,276 posted on 04/27/2024 6:10:34 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6272 | View Replies]


6,277 posted on 04/27/2024 6:16:00 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6274 | View Replies]


6,278 posted on 04/27/2024 8:35:20 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6256 | View Replies]

Russian Offensive Campaign Assessment, April 27, 2024

The Russian federal government continues efforts to codify increased control over migrant communities living in Russia. The Russian State Duma introduced a bill on April 27 that “proposes a number of innovations that will help modernize Russian legislation and resolve certain issues of ensuring national security in the field of migration.”[46] The proposed bill also includes provisions to introduce a deportation regime for migrants who “have no grounds” to be in Russia, including those who commit certain crimes.[47] The proposed bill will also prevent foreigners who are subject to the deportation regime from purchasing real estate, opening bank accounts, or getting married.[48] The deportation bill will allow the Russian federal government to define whichever foreign individuals or communities it chooses as subject to deportation—a move that will likely allow the government to extend more oppressive control over migrant communities and cater to Russian ultranationalists who have frequently called for such harsh policies.[49]

The Russian Ministry of Education and Science similarly announced on April 27 that the 12 Russian universities that are authorized to conduct Russian-language certification exams have terminated their contracts with commercial partners, meaning that only the universities and state and municipal organizations can administer Russian language certification testing.[50] This development will significantly complicate the process of obtaining Russian language certification for migrants, which will likely limit their access to certain jobs or even social services and provide the Russian government with greater control over migrant communities. The Russian government appears to be selectively empowering some migrant communities as it further disenfranchises others, however. A joint project run by Russian state media source RT and the Russian Ministry of Internal Affairs (MVD) called “Not One on One” sends requests to the MVD to help foreigners obtain Russian citizenship in certain limited cases.[51] The RT project reported that it sent a request to the MVD regarding the citizenship of a migrant from Kyrgyzstan who fled Kyrgyzstan for Russia after being convicted for fighting for Russian forces in Ukraine.[52] Russian authorities have increased crackdowns against Central Asian migrants living in Russia, particularly after the wake of the March 22 Crocus City Hall attack, and the RT project emphasizes the fact that the Russian government is interested in selectively protecting some migrants from Central Asian communities as long as they are ideologically useful in the context of the Russian war effort.

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-april-27-2024

6,279 posted on 04/28/2024 7:14:41 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6276 | View Replies]

Russian Blogger:

The deceased “Texas” was raped and killed by six military men. Friends of Russell Bentley, who are conducting their own investigation into his death, told us about this.

“We found out the names of all six culprits and handed them over to law enforcement officers. We will not name names publicly yet, so as not to please crests. We hope for a fair investigation and punishment for the killers,” said a close friend of “Texas”. The Ministry of Internal Affairs confirmed to us that we had received information about Bentley's probable killers. But they refused to provide information about whether an investigation into this matter is underway. We hope for a swift investigation and fair punishment for all those responsible for this crime.

https://t.me/kremlin_secrets/4006

Earlier https://freerepublic.com/focus/news/4232583/posts?page=66#66

6,280 posted on 04/28/2024 7:25:44 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6275 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 6,241-6,2606,261-6,2806,281-6,300 ... 6,941-6,956 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson