Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

DNA sleuths read the coronavirus genome, tracing its origins and looking for dangerous mutations
Stat ^ | JANUARY 24, 2020 | SHARON BEGLEY

Posted on 01/24/2020 10:29:27 PM PST by aquila48

click here to read article


Navigation: use the links below to view more comments.
first 1-2021-4041-6061-80 ... 121-127 next last

1 posted on 01/24/2020 10:29:27 PM PST by aquila48
[ Post Reply | Private Reply | View Replies]

To: aquila48

Consider this: Just 3 days ago the Chinese government was saying there is no human-human transmission.


2 posted on 01/24/2020 10:54:03 PM PST by Mariner (War Criminal #18)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Mariner

Read Richard Preston’s book “Hot Zone,” a true story of an Ebola virus going airborne in a Reston Virginia primate clearing house.


3 posted on 01/24/2020 11:04:08 PM PST by tired&retired (Blessings)
[ Post Reply | Private Reply | To 2 | View Replies]

To: tired&retired

The Hot Zone incident involved “Reston virus” rather than Ebola. It isn’t particularly dangerous to humans.


4 posted on 01/24/2020 11:08:41 PM PST by Pelham (RIP California, killed by massive immigration)
[ Post Reply | Private Reply | To 3 | View Replies]

To: aquila48

‘earlier than officials realised’. Cover for the commie cover up


5 posted on 01/25/2020 1:39:56 AM PST by Long Jon No Silver
[ Post Reply | Private Reply | To 1 | View Replies]

To: aquila48

The genome of the 24 available samples are very similar, indicating a single source for transmission to humans that occurred no earlier than 30 Oct 2019, and no later than 29 Nov 2019.

The virus has an incubation period of 14 days.

China reported the first case on 8 Dec 2019, and provided the complete sequence of the virus genome on 10 Jan 2020. The genome is 29,903 bases long. That 33 days shattered all previous records for sequencing a genome this long. A single mutation was all that was required for the virus to be able to infect humans.

It took more than 6 months to sequence the SARS virus from Oct 2002 to Apr 2003, which is 29,727 bases long.

Note that China has two large, sophisticated biological weapons research facilities within 20 miles of the city of Wuhan.

Coincidence? I think not. The Chinese had the novel coronavirus genome sequence all along, since they developed it.


6 posted on 01/25/2020 2:06:05 AM PST by Natty Bumppo@frontier.net (We are the dangerous ones, who stand between all we love and a more dangerous world.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Natty Bumppo@frontier.net

Kinda like a doomsday bomb if the castle is surrounded and the food is running out.


7 posted on 01/25/2020 2:23:06 AM PST by justa-hairyape (The user name is sarcastic. Although at times it may not appear that way.)
[ Post Reply | Private Reply | To 6 | View Replies]

To: aquila48; neverdem; ProtectOurFreedom; Mother Abigail; EBH; vetvetdoug; Smokin' Joe; Global2010; ...
Bring Out Your Dead

Post to me or FReep mail to be on/off the Bring Out Your Dead ping list.

The purpose of the “Bring Out Your Dead” ping list (formerly the “Ebola” ping list) is very early warning of emerging pandemics, as such it has a high false positive rate.

So far the false positive rate is 100%.

At some point we may well have a high mortality pandemic, and likely as not the “Bring Out Your Dead” threads will miss the beginning entirely.

*sigh* Such is life, and death...

If a quarantine saves just one child's life, it's worth it.

8 posted on 01/25/2020 3:06:36 AM PST by null and void (The government wants to disarm us after 243 yrs 'cuz they plan to do things we would shoot them for!)
[ Post Reply | Private Reply | To 1 | View Replies]

To: aquila48

A great read. Thanks for posting this.


9 posted on 01/25/2020 3:09:17 AM PST by MarMema (Proud co-pilot for John James)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Pelham

Thanks.

At the time they did not know... per Wiki:

Reston virus (RESTV) is one of six known viruses within the genus Ebolavirus. Reston virus causes Ebola virus disease in non-human primates; unlike the other five ebolaviruses, it is not known to cause disease in humans, but has caused asymptomatic infections.

Reston virus was first described in 1990 as a new “strain” of Ebola virus (EBOV).

It is the single member of the species Reston ebolavirus, which is included into the genus Ebolavirus, family Filoviridae, order Mononegavirales.

Reston virus is named after Reston, Virginia, US, where the virus was first discovered.

Following the test at the CDC campus in DeKalb County, two of the monkeys who had survived Reston virus infection were infected with a very large dose of the Ebola virus in an effort to produce an Ebola vaccine. One of the two monkeys remained resistant; the second died.

The physical building in which the outbreak occurred was demolished on 30 May 1995 and a daycare center was constructed in its place.


10 posted on 01/25/2020 5:14:40 AM PST by tired&retired (Blessings)
[ Post Reply | Private Reply | To 4 | View Replies]

To: aquila48

“...they’re getting backup that’s been possible only since the explosion in genetic technologies: a deep-dive into the DNA of the virus known as 2019-nCoV.”

Corona viruses have no DNA, only a single strand of RNA. However they can use the Reverse Transcriptase enzyme to convert the RNA strand to DNA.


11 posted on 01/25/2020 6:22:32 AM PST by Brooklyn Attitude (It's no coincidence that the Democrat/media complex always sides with America's enemies.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Brooklyn Attitude

“However they can use the Reverse Transcriptase enzyme to convert the RNA strand to DNA.”

To clarify “they” refers to the scientists.


12 posted on 01/25/2020 6:24:42 AM PST by Brooklyn Attitude (It's no coincidence that the Democrat/media complex always sides with America's enemies.)
[ Post Reply | Private Reply | To 11 | View Replies]

To: AdmSmith; AnonymousConservative; Arthur Wildfire! March; Berosus; Bockscar; cardinal4; ColdOne; ...

13 posted on 01/25/2020 8:54:05 AM PST by SunkenCiv (Imagine an imaginary menagerie manager imagining managing an imaginary menagerie.)
[ Post Reply | Private Reply | View Replies]

To: aquila48

Here is a link to a daily report being done on the worlwide spread of the disease:
................
https://bnonews.com/index.php/2020/01/the-latest-coronavirus-cases/
.................
There are the beginning rumors that this was a lab created disease. Not likely, as 6 of the first 7 patients were vendors at the Wuhan seafood market . They sell bats there for food.
................
This virus shares 80% of the SARS virus, its closest relative. It has a 96% match with a known virus in fruit bats. Snakes are not the origin.
................
This virus is much weaker than SARS but has some unusual traits. It is an RNA rather than a DNA virus like smallpox. That means that it mutates very quickly. Current patients are showing a 4th generation mutation from the original patients amonth ago.
..............
That makes vaccines very difficult to be effective.
..............
The new virus also has a very high binding energy to human tissue, about 4 times higher than SARS. That means that infection is far more likely when exposed. In fact, there are about 40% new patients every day, that is extraordinary.
...............
As usual, vulnerable people are more likely to die. Most people will be able to quickly fight off the virus.


14 posted on 01/25/2020 9:02:05 AM PST by gandalftb
[ Post Reply | Private Reply | To 1 | View Replies]

To: aquila48; nuconvert; SunkenCiv
13JAN2010:

Phylogenetic tree showing the relationship of Wuhan-Hu-1 (circled in red) to selected coronaviruses.

https://ncbiinsights.ncbi.nlm.nih.gov/2020/01/13/novel-coronavirus/

15 posted on 01/25/2020 9:02:56 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Natty Bumppo@frontier.net
Note that China has two large, sophisticated biological weapons research facilities within 20 miles of the city of Wuhan.

1979-nCoV is not a suitable bio-weapon.
16 posted on 01/25/2020 9:06:03 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6 | View Replies]

To: AdmSmith

Thanks


17 posted on 01/25/2020 9:06:07 AM PST by nuconvert ( Warning: Accused of being a radical militarist. Approach with caution.)
[ Post Reply | Private Reply | To 15 | View Replies]

To: aquila48

just reported that it DID NOT start at that seafood market and the first case may ave been dec 1


18 posted on 01/25/2020 9:07:48 AM PST by janetjanet998
[ Post Reply | Private Reply | To 1 | View Replies]

To: gandalftb

Estimated country-specific influenza-associated respiratory excess mortality rates (EMR).

The estimated mean annual influenza-associated respiratory EMR ranged from 0.1 to 6.4 per 100 000 individuals for people younger than 65 years, 2.9 to 44.0 per 100 000 individuals for people aged between 65 and 74 years, and 17.9 to 223.5 per 100 000 for people older than 75 years. We estimated that 291 243- 645 832 seasonal influenza-associated respiratory deaths (4.0 - 8.8 per 100 000 individuals) occur annually. The highest mortality rates were estimated in sub-Saharan Africa (2.8 - 16.5 per 100 000 individuals), southeast Asia (3.5 - 9.2 per 100 000 individuals), and among people aged 75 years or older (51.3 - 99.4 per 100 000 individuals). For 92 countries, we estimated that among children younger than 5 years, 9243 -105 690 influenza-associated respiratory deaths occur annually.

https://www.thelancet.com/journals/lancet/article/PIIS0140-6736(17)33293-2/fulltext

according to data so far the mortality is 3 %, SARS had less than 1% in patients below age 24 years to more than 50% in patients aged 65 and older.
https://emedicine.medscape.com/article/237755-overview


19 posted on 01/25/2020 9:34:28 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 14 | View Replies]

To: AdmSmith
That pork and rice imported from the US doesn't look so bad now, does it, hmm, commies?

20 posted on 01/25/2020 9:38:05 AM PST by SunkenCiv (Imagine an imaginary menagerie manager imagining managing an imaginary menagerie.)
[ Post Reply | Private Reply | To 15 | View Replies]


Navigation: use the links below to view more comments.
first 1-2021-4041-6061-80 ... 121-127 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson