Free Republic
Browse · Search
News/Activism
Topics · Post Article


1 posted on 01/24/2020 10:29:27 PM PST by aquila48
[ Post Reply | Private Reply | View Replies ]


To: aquila48

Consider this: Just 3 days ago the Chinese government was saying there is no human-human transmission.


2 posted on 01/24/2020 10:54:03 PM PST by Mariner (War Criminal #18)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: aquila48

‘earlier than officials realised’. Cover for the commie cover up


5 posted on 01/25/2020 1:39:56 AM PST by Long Jon No Silver
[ Post Reply | Private Reply | To 1 | View Replies ]

To: aquila48

The genome of the 24 available samples are very similar, indicating a single source for transmission to humans that occurred no earlier than 30 Oct 2019, and no later than 29 Nov 2019.

The virus has an incubation period of 14 days.

China reported the first case on 8 Dec 2019, and provided the complete sequence of the virus genome on 10 Jan 2020. The genome is 29,903 bases long. That 33 days shattered all previous records for sequencing a genome this long. A single mutation was all that was required for the virus to be able to infect humans.

It took more than 6 months to sequence the SARS virus from Oct 2002 to Apr 2003, which is 29,727 bases long.

Note that China has two large, sophisticated biological weapons research facilities within 20 miles of the city of Wuhan.

Coincidence? I think not. The Chinese had the novel coronavirus genome sequence all along, since they developed it.


6 posted on 01/25/2020 2:06:05 AM PST by Natty Bumppo@frontier.net (We are the dangerous ones, who stand between all we love and a more dangerous world.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: aquila48; neverdem; ProtectOurFreedom; Mother Abigail; EBH; vetvetdoug; Smokin' Joe; Global2010; ...
Bring Out Your Dead

Post to me or FReep mail to be on/off the Bring Out Your Dead ping list.

The purpose of the “Bring Out Your Dead” ping list (formerly the “Ebola” ping list) is very early warning of emerging pandemics, as such it has a high false positive rate.

So far the false positive rate is 100%.

At some point we may well have a high mortality pandemic, and likely as not the “Bring Out Your Dead” threads will miss the beginning entirely.

*sigh* Such is life, and death...

If a quarantine saves just one child's life, it's worth it.

8 posted on 01/25/2020 3:06:36 AM PST by null and void (The government wants to disarm us after 243 yrs 'cuz they plan to do things we would shoot them for!)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: aquila48

A great read. Thanks for posting this.


9 posted on 01/25/2020 3:09:17 AM PST by MarMema (Proud co-pilot for John James)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: aquila48

“...they’re getting backup that’s been possible only since the explosion in genetic technologies: a deep-dive into the DNA of the virus known as 2019-nCoV.”

Corona viruses have no DNA, only a single strand of RNA. However they can use the Reverse Transcriptase enzyme to convert the RNA strand to DNA.


11 posted on 01/25/2020 6:22:32 AM PST by Brooklyn Attitude (It's no coincidence that the Democrat/media complex always sides with America's enemies.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: aquila48

Here is a link to a daily report being done on the worlwide spread of the disease:
................
https://bnonews.com/index.php/2020/01/the-latest-coronavirus-cases/
.................
There are the beginning rumors that this was a lab created disease. Not likely, as 6 of the first 7 patients were vendors at the Wuhan seafood market . They sell bats there for food.
................
This virus shares 80% of the SARS virus, its closest relative. It has a 96% match with a known virus in fruit bats. Snakes are not the origin.
................
This virus is much weaker than SARS but has some unusual traits. It is an RNA rather than a DNA virus like smallpox. That means that it mutates very quickly. Current patients are showing a 4th generation mutation from the original patients amonth ago.
..............
That makes vaccines very difficult to be effective.
..............
The new virus also has a very high binding energy to human tissue, about 4 times higher than SARS. That means that infection is far more likely when exposed. In fact, there are about 40% new patients every day, that is extraordinary.
...............
As usual, vulnerable people are more likely to die. Most people will be able to quickly fight off the virus.


14 posted on 01/25/2020 9:02:05 AM PST by gandalftb
[ Post Reply | Private Reply | To 1 | View Replies ]

To: aquila48; nuconvert; SunkenCiv
13JAN2010:

Phylogenetic tree showing the relationship of Wuhan-Hu-1 (circled in red) to selected coronaviruses.

https://ncbiinsights.ncbi.nlm.nih.gov/2020/01/13/novel-coronavirus/

15 posted on 01/25/2020 9:02:56 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: aquila48

just reported that it DID NOT start at that seafood market and the first case may ave been dec 1


18 posted on 01/25/2020 9:07:48 AM PST by janetjanet998
[ Post Reply | Private Reply | To 1 | View Replies ]

Free Republic
Browse · Search
News/Activism
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson