Free Republic
Browse · Search
News/Activism
Topics · Post Article

To: aquila48

The genome of the 24 available samples are very similar, indicating a single source for transmission to humans that occurred no earlier than 30 Oct 2019, and no later than 29 Nov 2019.

The virus has an incubation period of 14 days.

China reported the first case on 8 Dec 2019, and provided the complete sequence of the virus genome on 10 Jan 2020. The genome is 29,903 bases long. That 33 days shattered all previous records for sequencing a genome this long. A single mutation was all that was required for the virus to be able to infect humans.

It took more than 6 months to sequence the SARS virus from Oct 2002 to Apr 2003, which is 29,727 bases long.

Note that China has two large, sophisticated biological weapons research facilities within 20 miles of the city of Wuhan.

Coincidence? I think not. The Chinese had the novel coronavirus genome sequence all along, since they developed it.


6 posted on 01/25/2020 2:06:05 AM PST by Natty Bumppo@frontier.net (We are the dangerous ones, who stand between all we love and a more dangerous world.)
[ Post Reply | Private Reply | To 1 | View Replies ]


To: Natty Bumppo@frontier.net

Kinda like a doomsday bomb if the castle is surrounded and the food is running out.


7 posted on 01/25/2020 2:23:06 AM PST by justa-hairyape (The user name is sarcastic. Although at times it may not appear that way.)
[ Post Reply | Private Reply | To 6 | View Replies ]

To: Natty Bumppo@frontier.net
Note that China has two large, sophisticated biological weapons research facilities within 20 miles of the city of Wuhan.

1979-nCoV is not a suitable bio-weapon.
16 posted on 01/25/2020 9:06:03 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6 | View Replies ]

Free Republic
Browse · Search
News/Activism
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson