Free Republic
Browse · Search
News/Activism
Topics · Post Article

To: aquila48

Here is a link to a daily report being done on the worlwide spread of the disease:
................
https://bnonews.com/index.php/2020/01/the-latest-coronavirus-cases/
.................
There are the beginning rumors that this was a lab created disease. Not likely, as 6 of the first 7 patients were vendors at the Wuhan seafood market . They sell bats there for food.
................
This virus shares 80% of the SARS virus, its closest relative. It has a 96% match with a known virus in fruit bats. Snakes are not the origin.
................
This virus is much weaker than SARS but has some unusual traits. It is an RNA rather than a DNA virus like smallpox. That means that it mutates very quickly. Current patients are showing a 4th generation mutation from the original patients amonth ago.
..............
That makes vaccines very difficult to be effective.
..............
The new virus also has a very high binding energy to human tissue, about 4 times higher than SARS. That means that infection is far more likely when exposed. In fact, there are about 40% new patients every day, that is extraordinary.
...............
As usual, vulnerable people are more likely to die. Most people will be able to quickly fight off the virus.


14 posted on 01/25/2020 9:02:05 AM PST by gandalftb
[ Post Reply | Private Reply | To 1 | View Replies ]


To: gandalftb

Estimated country-specific influenza-associated respiratory excess mortality rates (EMR).

The estimated mean annual influenza-associated respiratory EMR ranged from 0.1 to 6.4 per 100 000 individuals for people younger than 65 years, 2.9 to 44.0 per 100 000 individuals for people aged between 65 and 74 years, and 17.9 to 223.5 per 100 000 for people older than 75 years. We estimated that 291 243- 645 832 seasonal influenza-associated respiratory deaths (4.0 - 8.8 per 100 000 individuals) occur annually. The highest mortality rates were estimated in sub-Saharan Africa (2.8 - 16.5 per 100 000 individuals), southeast Asia (3.5 - 9.2 per 100 000 individuals), and among people aged 75 years or older (51.3 - 99.4 per 100 000 individuals). For 92 countries, we estimated that among children younger than 5 years, 9243 -105 690 influenza-associated respiratory deaths occur annually.

https://www.thelancet.com/journals/lancet/article/PIIS0140-6736(17)33293-2/fulltext

according to data so far the mortality is 3 %, SARS had less than 1% in patients below age 24 years to more than 50% in patients aged 65 and older.
https://emedicine.medscape.com/article/237755-overview


19 posted on 01/25/2020 9:34:28 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 14 | View Replies ]

To: gandalftb

Of the original 41 infected not one had any compromising illness and they were healthy middle aged men. This rumor about the elderly only needs to be squashed.


44 posted on 01/26/2020 12:37:17 AM PST by MarMema (Proud co-pilot for John James)
[ Post Reply | Private Reply | To 14 | View Replies ]

Free Republic
Browse · Search
News/Activism
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson