Free Republic
Browse · Search
News/Activism
Topics · Post Article


1 posted on 07/22/2016 10:20:52 PM PDT by proust
[ Post Reply | Private Reply | View Replies ]


Navigation: use the links below to view more comments.
first previous 1-2021-4041-60 last
To: proust

Enough evidence for a “reasonable” prosecutor to bring a case?


109 posted on 07/23/2016 5:09:26 AM PDT by kevao (Biblical Jesus: Give your money to the poor. Socialist Jesus: Give your neighbor's money to the poor)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: proust

If Julian Assange releases damaging information the day of her convention speech, I’d say he was a master showman.

But I know that’s just a lot of wishful thinking.


110 posted on 07/23/2016 5:11:03 AM PDT by CaptainK (...please make it stop. Shake a can of pennies at it.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: proust

Bkmk


113 posted on 07/23/2016 5:16:10 AM PDT by novemberslady
[ Post Reply | Private Reply | To 1 | View Replies ]

To: proust
Obama will pardon her. Just like the Gov. of Virginia faced with the State Supreme Court ruling overturning his blanket restoration of voting rights for felons, has promised to hand-process clemency for all 200,000 of them.

There *is* an answer to this, but it's not pretty.

118 posted on 07/23/2016 5:39:53 AM PDT by grey_whiskers (The opinions are solely those of the author and are subject to change without notice.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: proust

Even if Ambassador Chris Stevens, who is gay, was wearing a blue evening gown when he was murdered, and even if Hillary’s DNA was on the fabric, proving she had a hand in his murder, an indictment is not going to happen. She’s a Clinton. Nothing, not even DNA evidence on a dress, is enough to convict her.


119 posted on 07/23/2016 5:49:04 AM PDT by Pollster1 (Somebody who agrees with me 80% of the time is a friend and ally, not a 20% traitor. - Ronald Reagan)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: proust; SunkenCiv; TigerLikesRooster
I can't stand Hillary but Russian — sorry “Wikileaks” — naked intervention in a US Presidential election ought to anger every American.

John Schindler
https://twitter.com/20committee/status/756821673916129280

Background: https://20committee.com/2016/07/02/the-kremlin-admits-snowden-is-a-russian-agent/

120 posted on 07/23/2016 5:55:41 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: proust

Did you notice the qualifier at the end of the statement,THEY COULD lead to trouble.
Key word COULD,so please stop with the BS,the just us dept. Will not do nothing against hillary


123 posted on 07/23/2016 6:13:46 AM PDT by ballplayer (hvexx NKK c bmytit II iyijjhihhiyyiyiyi it iyiiy II i hi jiihi ty yhiiyihiijhijjyjiyjiiijyuiiijihyii)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: proust
. . . documents that will provide "enough evidence" for the Department of Justice to indict the presumptive Democratic nominee.

There's more than enough evidence already. It's not the evidence that counts, but the seriousness of the charges, and since those charges come from "conservatives," they can't be serious. The DOJ has already said quite plainly that Hillary Clinton is above the Law. NOTHING in this current administration will keep her from using the United States Government as a tool for self-aggrandizement.

125 posted on 07/23/2016 6:54:11 AM PDT by Fester Chugabrew (Diversity is Hillary Clinton and Barack Obama sharing the same jail cell.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: proust

There could be videos of Hillary strangling puppies and there would still be no indictment from this corrupt DOJ and she would still be the darling of the media


129 posted on 07/23/2016 7:35:27 AM PDT by The Great RJ ("Socialists are happy until they run out of other people's money." Margaret Thatcher)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: proust; ViLaLuz; ROCKLOBSTER; BlessedBeGod; Kevin in California; Kenny; vpintheak; Rurudyne; ...
The title of that story does not match its content. Inside the article, it quotes Assange as saying an indictment is impossible to happen...
Assange expressed a lack of confidence in the Obama administration’s Justice Department to indict the former Secretary of State.

“[Attorney General Loretta Lynch] is not going to indict Hillary Clinton. It’s not possible that could happen.
But the FBI could push for new concessions from the Clinton government in exchange for its lack of indictment.”


130 posted on 07/23/2016 8:13:00 AM PDT by Future Useless Eater (Obama wants nuclear war with RU or NK by October. How would Americans know who REALLY started it?)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: proust

I think he wants her nominated for Democrats before laying down the hammer.
He must be pissed at Obama and Hillary.


134 posted on 07/23/2016 9:04:32 AM PDT by A CA Guy (God Bless America, God Bless and keep safe our fighting men and women.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: proust

138 posted on 07/23/2016 9:37:36 AM PDT by orchestra ((And there were also two other, malefactors, led with him to be put to death.))
[ Post Reply | Private Reply | To 1 | View Replies ]

To: proust

They already have enough to indict?


144 posted on 07/23/2016 10:42:26 AM PDT by TruthWillWin (The problem with socialists is that you eventually run out of other peoples money.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: proust

It will be released on the same day Sheriff Arapio release his info on Obama. /s


150 posted on 07/23/2016 1:07:17 PM PDT by wintertime (Stop treating government teachers like they are reincarnated Mother Teresas!)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: proust

Yeah, right.....


153 posted on 07/23/2016 8:56:30 PM PDT by Intolerant in NJ
[ Post Reply | Private Reply | To 1 | View Replies ]

To: proust

Is he talking about the emails just released or are there more to come?


157 posted on 07/23/2016 10:34:01 PM PDT by kalee
[ Post Reply | Private Reply | To 1 | View Replies ]

To: proust

This is Putin’s play.


162 posted on 07/24/2016 8:26:04 AM PDT by Uncle Miltie (This posting is a microaggression.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: proust

WikiLeaks founder Julian Assange says his next leak will virtually guarantee an indictment of Hillary Clinton.

Sure it will... and snake oil will cure whatever ails ya. Lotta this kind of thing going around the net, and it's just not the kind of thing I'd want to take to the bank.

164 posted on 07/24/2016 12:05:16 PM PDT by Kenton
[ Post Reply | Private Reply | To 1 | View Replies ]

To: proust
To put it bluntly, there is no way in HELL that the Obama In-Justice Department will EVER indict Hillary Clinton, no matter how overwhelming the evidence is.

That's already been proven.

I'll even say that there's no way a Trump Justice Department will do it either. One President allowing a former President to be indicted for crimes against America?

Never happen. Period. I damn' sure wish it would, but it won't.

168 posted on 07/25/2016 5:56:12 PM PDT by usconservative (When The Ballot Box No Longer Counts, The Ammunition Box Does. (What's In Your Ammo Box?))
[ Post Reply | Private Reply | To 1 | View Replies ]

To: proust
One of these is not like the other.

"WikiLeaks founder says his next leak will virtually guarantee an indictment of Hillary"

"While Assange didn’t specify what exactly was in the emails, he did tell ITV that WikiLeaks had “accumulated a lot of material about Hillary Clinton, which could proceed to an indictment.” "Assange said the whistleblowing website will soon be leaking documents that will provide “enough evidence” for the Department of Justice to indict the presumptive Democratic nominee."

Obama's Just Us Department? Well, maybe not. Quoting Assange, “[Attorney General Loretta Lynch] is not going to indict Hillary Clinton. It’s not possible that could happen."

OK, that's a complete contradiction of the title of the article, isn't it? Making me wonder if the title was just click-bait.

171 posted on 07/26/2016 8:53:30 AM PDT by Kenton
[ Post Reply | Private Reply | To 1 | View Replies ]


Navigation: use the links below to view more comments.
first previous 1-2021-4041-60 last

Free Republic
Browse · Search
News/Activism
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson