The CIA's AQ desk is back in action!
Navigation: use the links below to view more comments.
first 1-20, 21-23 next last
To: Mr. M.J.B.
2 posted on
05/09/2016 6:48:13 PM PDT by
MUDDOG
To: Mr. M.J.B.
Kill he bastard!~~~~~~~~~~~~~
3 posted on
05/09/2016 6:48:55 PM PDT by
Stayfree
(FlushHillary.com says "NEVER HILLARY", "NEVER HILLARY", "NEVER HILLARY")
To: Mr. M.J.B.
To: Mr. M.J.B.
6 posted on
05/09/2016 6:52:10 PM PDT by
gaijin
To: Mr. M.J.B.
US Jewish institutions are on alert but the vote will likely be 65/35 for dems. I don’t get it and never will.
7 posted on
05/09/2016 6:55:05 PM PDT by
dp0622
(The only thing an upper crust conservative hates more than a liberal is a middle class conservative)
To: Mr. M.J.B.
He can join his father in hell any time he wishes.
8 posted on
05/09/2016 6:57:00 PM PDT by
boycott
(--s)
To: Mr. M.J.B.
Why is he alive? Just curious.
9 posted on
05/09/2016 6:57:39 PM PDT by
WENDLE
(Hillary committed crimes!! Why the delay?)
To: Mr. M.J.B.
Why are any bin Ladens still alive?
11 posted on
05/09/2016 7:01:58 PM PDT by
E. Pluribus Unum
("If voting made any difference they wouldn't let us do it." --Samuel Clemens)
To: Mr. M.J.B.
"Bin Laden’s son calls to target Jewish, US, Western interests..." ..... Well ..... That's pretty much the only thing the Religion of Peace ever targets. Guess Bin Laden Jr. just needed something new to put on his FaceBook page.
12 posted on
05/09/2016 7:05:35 PM PDT by
R_Kangel
( "A Nation of Sheep ..... Will Beget ..... a Nation Ruled by Wolves.")
To: Mr. M.J.B.
Quick, call the Obama-led Anti-Defamation League. Tell them that Little Binnie Laden is anti-Semitic. They can now do a report on him after checking with the Southern Poverty Law Center, Afghanistan branch.
To: Mr. M.J.B.
If I was president trump I would order him to be dead within 48 hours
16 posted on
05/09/2016 7:09:36 PM PDT by
Mr. K
(Trump will win NY state - choke on that HilLIARy)
To: Mr. M.J.B.
Unfortunately for us, øbama agrees.
17 posted on
05/09/2016 7:11:19 PM PDT by
onedoug
To: Mr. M.J.B.
I’m no prophet, but I predict an airstrike on Hamza’s motorcade or residence is in his future.
22 posted on
05/09/2016 7:25:26 PM PDT by
OldNewYork
(Operation Wetback II, now with computers)
To: Mr. M.J.B.
Thought his two sons were vaporized. How many sons were/are there?
23 posted on
05/09/2016 7:29:18 PM PDT by
Gene Eric
(Don't be a statist!)
To: Mr. M.J.B.
from where....?
iran ...???
24 posted on
05/09/2016 7:45:31 PM PDT by
zzwhale
To: Mr. M.J.B.
25 posted on
05/09/2016 7:57:35 PM PDT by
faithhopecharity
("Politicians are not born, they're excreted." Marcus Tullius Cicero (106 -- 43 BCE))
To: Mr. M.J.B.
He’s clearly bucking for a US taxpayer-funded, one-way ticket to join his father.
To: Mr. M.J.B.
Hamza now. Whatever happened to Said [the eldest son]?
27 posted on
05/09/2016 8:36:33 PM PDT by
kozanne
To: Mr. M.J.B.; SunkenCiv; ETL
33 posted on
05/10/2016 3:48:07 AM PDT by
AdmSmith
(GCTGATATGTCTATGATTACTCAT)
To: Mr. M.J.B.
These murderers are protected
by the Bushes,
by the Clintons,
by the treasonous, hated, EXEMPT, GOP,
and the Obamas.
34 posted on
05/10/2016 3:58:02 AM PDT by
Diogenesis
("When a crime is unpunished, the world is unbalanced.")
Navigation: use the links below to view more comments.
first 1-20, 21-23 next last
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson
