Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

Bin Laden’s son calls to target Jewish, US, Western interests
Jerusalem Post ^ | 5/10/2016 | Ariel Ben Solomon

Posted on 05/09/2016 6:45:23 PM PDT by Mr. M.J.B.

Hamza Bin Laden, the son of former al-Qaida leader Osama bin Laden, is calling for the targeting of Jewish and Western interests and the building of an army to “liberate Jerusalem.”

US Jewish institutions on alert following calls for attacks from bin Laden’s son.


TOPICS: Egypt; Front Page News; Germany; Israel; News/Current Events; Russia; Syria; US: New York; United Kingdom; War on Terror
KEYWORDS: 2016election; alciada; clintonfailure; clintonlegacy; egypt; election2016; eritrea; europeanunion; germany; iran; iraq; israel; jihad; jordan; kgb; kurdistan; lebanon; nato; newyork; obamafailure; obamalegacy; patricelumumbaschool; russia; sinai; syria; trump; unitedkingdom; waronterror; yemen
Navigation: use the links below to view more comments.
first previous 1-2021-4041-46 next last
To: boycott

More fish food.

This would not be a problem now if the Russians had a skyscraper knocked down, because everyone to second cousins and classmates thereof would have been disappeared by 2003.


21 posted on 05/09/2016 7:24:13 PM PDT by The Antiyuppie ("When small men cast long shadows, then it is very late in the day".)
[ Post Reply | Private Reply | To 8 | View Replies]

To: Mr. M.J.B.

I’m no prophet, but I predict an airstrike on Hamza’s motorcade or residence is in his future.


22 posted on 05/09/2016 7:25:26 PM PDT by OldNewYork (Operation Wetback II, now with computers)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Mr. M.J.B.

Thought his two sons were vaporized. How many sons were/are there?


23 posted on 05/09/2016 7:29:18 PM PDT by Gene Eric (Don't be a statist!)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Mr. M.J.B.

from where....?
iran ...???


24 posted on 05/09/2016 7:45:31 PM PDT by zzwhale
[ Post Reply | Private Reply | To 1 | View Replies]

To: Mr. M.J.B.

One more job for Mossad


25 posted on 05/09/2016 7:57:35 PM PDT by faithhopecharity ("Politicians are not born, they're excreted." Marcus Tullius Cicero (106 -- 43 BCE))
[ Post Reply | Private Reply | To 1 | View Replies]

To: Mr. M.J.B.

He’s clearly bucking for a US taxpayer-funded, one-way ticket to join his father.


26 posted on 05/09/2016 8:14:45 PM PDT by Jack Hammer
[ Post Reply | Private Reply | To 1 | View Replies]

To: Mr. M.J.B.

Hamza now. Whatever happened to Said [the eldest son]?


27 posted on 05/09/2016 8:36:33 PM PDT by kozanne
[ Post Reply | Private Reply | To 1 | View Replies]

To: boycott

Debbie Schlussel calls it Jewicide.


28 posted on 05/09/2016 8:37:05 PM PDT by kozanne
[ Post Reply | Private Reply | To 10 | View Replies]

To: The Antiyuppie

This would not be a problem now if the Russians had a skyscraper knocked down, because everyone to second cousins and classmates thereof would have been disappeared by 2003.


And I would have cheered them on.


29 posted on 05/09/2016 9:12:17 PM PDT by boycott (--s)
[ Post Reply | Private Reply | To 21 | View Replies]

To: gaijin

Kid, you have a poop-filled diaper on your head, and you want to be take. seriously?


30 posted on 05/09/2016 9:14:13 PM PDT by ConservativeMind ("Humane" = "Don't pen up pets or eat meat, but allow infanticide, abortion, and euthanasia.")
[ Post Reply | Private Reply | To 6 | View Replies]

To: gaijin

Remember the video well was played So many times here. Thanks for reminder We will Never forget those times.


31 posted on 05/09/2016 10:30:57 PM PDT by easternsky
[ Post Reply | Private Reply | To 6 | View Replies]

To: Gene Eric; kozanne; Mr. M.J.B.; All

Osama was one of some 54 children of the same father by various wives. It is a BIG family. Here is a detailed article on the complexities of the bin Ladin family.

https://en.wikipedia.org/wiki/Bin_Laden_family


32 posted on 05/10/2016 12:14:18 AM PDT by gleeaikin
[ Post Reply | Private Reply | To 23 | View Replies]

To: Mr. M.J.B.; SunkenCiv; ETL

@Mr. M.J.B. You have no knowledge about this?

http://www.businessinsider.com/exploring-al-qaedas-murky-connection-to-russian-intelligence-2014-6

https://kyleorton1991.wordpress.com/2015/09/08/how-russia-manipulates-islamic-terrorism/


33 posted on 05/10/2016 3:48:07 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Mr. M.J.B.

These murderers are protected
by the Bushes,
by the Clintons,
by the treasonous, hated, EXEMPT, GOP,
and the Obamas.


34 posted on 05/10/2016 3:58:02 AM PDT by Diogenesis ("When a crime is unpunished, the world is unbalanced.")
[ Post Reply | Private Reply | To 1 | View Replies]

To: Mr. M.J.B.; LucyT

Hamza bin Laden is al-Harbi, and is Osama bin-Laden’s son who was tagged 3-B status – terrorist. Yet a student visa was granted after terrorist status was assigned to him.

He was in Boston for the Boston Marathon bombing. He spent time in the hospital for burned hands since he was handling those pressure cooker bombs. You know, the bombs for which a Chechen patsy is in jail under a death sentence.

Hamza bin Laden is a good friend of the Obama Administration, and has been in-and-out of the White House about a dozen times. He is protected by the Saudi royals.

See: http://beforeitsnews.com/war-on-terror/2013/04/that-detained-saudi-student-named-al-harbi-is-actually-osama-bin-ladens-son-hamza-bin-laden-2443560.html


35 posted on 05/10/2016 5:05:52 AM PDT by SatinDoll (A NATURAL BORN CITIZEN IS BORN IN THE USA OF TWO USA CITIZENS)
[ Post Reply | Private Reply | To 1 | View Replies]

To: artichokegrower

Lol


36 posted on 05/10/2016 6:07:18 AM PDT by ElisabethInCincy
[ Post Reply | Private Reply | To 4 | View Replies]

To: WENDLE

This little bastard is living proof of why the Mafia wipes out a family to the third generation when inflicting a vendetta.


37 posted on 05/10/2016 6:20:44 AM PDT by Farmer Dean (Never be more than two steps away from your weapon.)
[ Post Reply | Private Reply | To 9 | View Replies]

To: dp0622

Hillary!’s Jewish donors will be cutting checks to this guy next week.


38 posted on 05/10/2016 6:23:25 AM PDT by Sgt_Schultze (If a border fence isn't effective, why is there a border fence around the White House?)
[ Post Reply | Private Reply | To 7 | View Replies]

To: SatinDoll
Do you have a more reliable source for this.

Nothing about this in the report signed by Rep. McCaul March 2014, i.e one year after your ref.

https://homeland.house.gov/files/documents/Boston-Bombings-Report.pdf

39 posted on 05/10/2016 7:28:38 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 35 | View Replies]

To: AdmSmith

Most of the info I have on this creep is my memories of the Boston Marathon bombing. I was researching the investigation as the situation developed.

He was a frequent guest at the White House before the bombing, FLOTUS visited him in the hospital, and all photos have either been photo shopped or scrubbed. He is an enemy of the United States - that is all I need to know.

He was arrested in Boston the day of the bombing, identified by a witness as having set off one of the bombs. That is why his hands were burned. Photos of his bandaged hands have now been photo shopped so no bandages appear.

As for “reliable sources”, as is typical of the NWO who control all news media, I guess you will have to rely on people like me who value liberty and truth.


40 posted on 05/10/2016 7:39:02 AM PDT by SatinDoll (A NATURAL BORN CITIZEN IS BORN IN THE USA OF TWO USA CITIZENS)
[ Post Reply | Private Reply | To 39 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-2021-4041-46 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson