[PatrickHenry]

Note how The Discovery Institute is described as a conservative think tank.

[PatrickHenry]

Evolution Ping! This list is for the evolution side of evolution threads, and maybe other science topics like cosmology.
See the list's description in my freeper homepage. Then FReepmail me to be added or dropped.

[js1138]

This is slightly off-topic, but has anyone read Philip Pullman's "His Dark Materials" trilogy?

[Cboldt]

Evolution is a theory, not a fact, regarding the origin of living things.

Well, that seems to be factual. Evolution is on stronger footing when examining a change from one living thing to a similar living thing, than it is when examining a change from dead/inanimate things to a living thing.

[Long Cut]

""The disclaimer says, 'This textbook contains material on evolution. Evolution is a theory, not a fact, regarding the origin of living things."

In this one "disclaimer", they reveal their utter ignorance about the TOE, and science in general.

In the first place, they repeat the common (wrong) misconception about what a scientific theory is. In the second, they continue to ignore the fact that evolution does not study the origins of life itself.

This "disclaimer" was obviously written by the same people pushing for it.

As you said, PH, those too ignorant to understand what they are talking about should not have any say in its presentation.

One sincerely hopes that the students, in their science classes, are being taught what a scientific theory REALLY is, and what evolution does and does not adress. If so, the need for a "disclaimer" is moot.

Were I teaching science there, I'd use the "disclaimer" itself as a teaching tool, to show how badly some scientific things are misunderstood.

[Physicist]

Evolution is a theory, not a fact, regarding the origin of living things.

Wrong. Evolution is a theory AND a fact. The theory of evolution is that variations are passed on to offspring, and selected by relative reproductive success. The fact of evolution is that allele frequencies change over time, and have throughout the history of life on Earth. The theory may or may not be correct--the evidence for it is extremely strong--but the fact is irrefutable.

[longshadow]

The SBC says that by the time they are 18 years old, nearly 90-percent of the children raised in evangelical homes have left the church, never to return. The attrition problem has Southern Baptist leaders so concerned that earlier this year, prominent members of the church asked their national convention to consider a resolution that would have called on Southern Baptist parents to remove their children from the nation's public schools.

So, instead of looking in the mirror to figure out what's driving so many young people out of their church, they point the finger of blame at an external imfluence they can demonize, rather than face the specter that being out of touch with reality might be the reason why so many young people are quitting.

[AndrewC]

"The disclaimer says, 'This textbook contains material on evolution. Evolution is a theory, not a fact, regarding the origin of living things. This material should be approached with an open mind, studied carefully, and critically considered,'" says attorney Michael Manely who represents a parent group from Cobb County, which has sued the school board, demanding the disclaimer be removed. The group says the county is trying to force religion into the schools.

Such compelling logic. A simple label will bring about the demise of freedom, but the icy hand covering the mouths of dissenters will not.

"This textbook contains material on evolution. Evolution is a theory, not a fact, regarding the origin of living things. This material should be approached with an open mind, studied carefully, and critically considered..." = "sermon".

[RightWingAtheist]

So are they implying that the National Center for Science Education is a liberal group?

[Heartlander]

Liberal ARRRRGHHH!-ument --- Conservative Placemarker.

(See C-Span)

[Amelia]

"Well, I think the sticker is appropriate," says Barrett Duke, the Vice-President for Public Policy of the Southern Baptist Convention. "I think it's appropriate for students to understand that evolution is a theory; It is not fact."

Obviously there are many people in Cobb County who do not understand the meaning scientists give to the word "theory". Perhaps they should read Chapter 1 of the textbook, which more than likely discusses the scientific method.

Meanwhile, it must be confusing to students and infuriating for the science teachers to see "theory" and "hypothesis" used interchangably like this by officials in science class.

[ChevyZ28]

While attending our local public high school, we had a biology book that taught all life evolved from single celled organisms, perhaps, hundreds of millions of years ago, if not billions of years ago. In fact, the biology book from which I studied in high school contained this aforementioned theory in the Preface. Not only did this Biology book contain this theory, but constantly stated and restated the theory. I attended public school in North Carolina.

There are scientists, who do in fact, regardless of how passionately you evolutionists try to argue otherwise, say evolution explains the basis and existence of all life on Earth. This is the problem all people who argue against evolution have with evolution.

I have been on record as saying many times evolution did not happen, is not happening and could never happen. Life is too complex and intricate to have evolved over a period millions of years. I view scientific evidence the same way I view polls. Any group can make any conclusion come from the evidence they provide depending on what their particular mission is. In other words, evidence and polls can be manipulated to bring a desired conclusion. This concept takes place in our court system on a daily basis, as well as other areas of life. If you do not believe what I have just stated about not just scientific evidence but polls also, then all I can say for you my friend is you are deceived .

I will tell you one thing I know to be fact. There is a God in Heaven. He sent His only begotten Son to this Earth to die for us. His Son did in fact die on the cross on Calvary, He rose again on the Third Day. Jesus is His Name. Some day the eastern sky IS going to split. We ALL are going to stand before Him in judgment. All things that are secret will be made known, and all things known will be made secret. One day every knee shall bow and every tongue confess that Jesus Christ Is Lord!!! On that day, we will learn absolutely, that God Himself breathed life in to man, and formed all life in the Palm of His Hand.

I know criticism of all kinds are coming my way the very minute this gets posted. Let the criticisms come, I would rather be criticized and right, than supported and wrong. With all of that said, the disclaimer should have included ALL of the theories contained in the science book used by the Cobb County Public School System. The disclaimer in no way, shape or form even mentioned religion; and yet, somehow, not only have you good folks leaped a huge leap to say this disclaimer pushes religion, so does the group filing the suit. Man has completely ignored the existence of God, and replaced Him with evolution and all kinds of other ideas, and then have the audacity to wonder why our country is in such a shocking state of moral decay. Will the irony ever cease???

[rmmcdaniell]

ATTAATACTGAACTCCTTATTGGTGAGAATACCGACGAGTCAATCGGAAACATAAGCAATACCAGCTGTATAGAGAATTGTGAA

[<1/1,000,000th%]

The Discovery Institute, the conservative think-tank [ARRRRGHHH!] behind Intelligent Design, says it does not endorse the theory's inclusion in school curriculum, only the presentation of "scientific weaknesses" it sees in Darwinian evolution.

Time to turn in the cell phones and computers. They don't exist.

[azhenfud]

I know the scriptures teach God formed all living creatures from "the dust of the earth".

Now, if I had no conceptual knowledge of single-celled lifeforms as they did 2500BC, I would prolly consider them "dust of the earth" and His "forming" to coincide with lifeforms' "transforming", or "evolving".

However the fact remains, there are still MANY facets to that diamond we may never view. Too many missing pieces remain undiscovered to definitively say. Some - as I - believe a Creator to be the source of all life and that by His influences, life changes.

Wouldn't we be a bored bunch if we could suddenly prove our debate or if we just quit asking questions?

What "Father" would give his child a gift and think it were appreciated if the child never expressed an interest to open it?