New Dinosaur Species Found in India

AP ^ | August 13, 2003 | RAMOLA TALWAR BADAM

[nwrep]

New Dinosaur Species Found in India

2 hours, 55 minutes ago

Add Top Stories - AP to My Yahoo!

By RAMOLA TALWAR BADAM, Associated Press Writer

BOMBAY, India - U.S. and Indian scientists said Wednesday they have discovered a new carnivorous dinosaur species in India after finding bones in the western part of the country.

AP Photo Missed Tech Tuesday? Check out the powerful new PDA crop, plus the best buys for any budget

The new dinosaur species was named Rajasaurus narmadensis, or "Regal reptile from the Narmada," after the Narmada River region where the bones were found.

The dinosaurs were between 25-30 feet long, had a horn above their skulls, were relatively heavy and walked on two legs, scientists said. They preyed on long-necked herbivorous dinosaurs on the Indian subcontinent during the Cretaceous Period at the end of the dinosaur age, 65 million years ago.

"It's fabulous to be able to see this dinosaur which lived as the age of dinosaurs came to a close," said Paul Sereno, a paleontologist at the University of Chicago. "It was a significant predator that was related to species on continental Africa, Madagascar and South America."

Working with Indian scientists, Sereno and paleontologist Jeff Wilson of the University of Michigan reconstructed the dinosaur skull in a project funded partly by the National Geographic (news - web sites) Society.

A model of the assembled skull was presented Wednesday by the American scientists to their counterparts from Punjab University in northern India and the Geological Survey of India during a Bombay news conference.

Scientists said they hope the discovery will help explain the extinction of the dinosaurs and the shifting of the continents — how India separated from Africa, Madagascar, Australia and Antarctica and collided with Asia.

The dinosaur bones were discovered during the past 18 years by Indian scientists Suresh Srivastava of the Geological Survey of India and Ashok Sahni, a paleontologist at Punjab University.

When the bones were examined, "we realized we had a partial skeleton of an undiscovered species," Sereno said.

The scientists said they believe the Rajasaurus roamed the Southern Hemisphere land masses of present-day Madagascar, Africa and South America.

"People don't realize dinosaurs are the only large-bodied animal that lived, evolved and died at a time when all continents were united," Sereno said.

The cause of the dinosaurs' extinction is still debated by scientists. The Rajasaurus discovery may provide crucial clues, Sereno said.

India has seen quite a few paleontological discoveries recently.

In 1997, villagers discovered about 300 fossilized dinosaur eggs in Pisdura, 440 miles northeast of Bombay, that Indian scientists said were laid by four-legged, long-necked vegetarian creatures.

Indian scientists said the dinosaur embryos in the eggs may have suffocated during volcanic eruptions.

[BMCDA]

Evos say that apes and we share a common ancestor? True or false? Through mutations over time man evolved upward from ape-like to man. At some point a radical enough change occurred that he was fully man (unless you just consider all men part apes). He had to have a mate. Unless a suitable female evolved exactly the same way he did, she still had part ape in her. If she did evolve exactly the way he did, why? Each person's genetics are different. A child can inherit a parent's gene, but to have a husband and wife arriving at that same point of fully human at the exact same time seems a little odd. Of course, having an ape turn, over time and mutation, into a higher form of species, namely man, is a bit odd too.

Now here is your misconception: there is no such thing as "fully human" or "fully ape". There is no guarantee that we (or they) will remain what we consider at the moment to be "fully human" resp. "fully ape".
Somehow you seem to think that there is a predetermined goal towards which a population must evolve.

You can imagine such a population as a cloud that moves in a certain direction (determined by external influences). Within this "cloud" every individual is compatible with the rest so every male and female can have offspring.

Now at some point this "cloud" splits up and the two halves drift apart. But the more they depart from each other the harder it is for an indivdual from one "cloud" to produce offspring with an other individual from the other "cloud". Of course within each "cloud" males and females are still able to have viable and fertile offspring together.

A good example of two such "clouds" that have separated only recently are donkeys and horses: they can produce viable but infertile offspring.
An other example where these the two "clouds" moved even further appart is the camel and the llama: here you have to use artificial insemination to get any offspring.

[Alamo-Girl]

No problem, then! Hugs!!!

[Alamo-Girl]

Thank you so very much for the kind words and encouragements and for explaining your recurring experience with such assertions!

[Ichneumon]

LOL now they will post a dozen sites that confirm "speciation". So predictable.

Oh no, it's predictable that we have and will post lots of evidence supporting our position. How intolerable!

[Ichneumon]

Some here could argue with a fence post,....AND WIN!

Well I should hope so...

Conversely, some could argue with a fence post... And lose.

[goodseedhomeschool (returned)]

LOL what you call "evidence" some would call redundant arguments of circular reasoning. Just a thought.

[goodseedhomeschool (returned)]

You forgot that some are just plain fence posts.

[bondserv]

Are there mutations that apes have that humans don't have?

By your reasoning this would argue for uncommon decent.

By my reasoning, the similarities that man and apes have genetically would cause me to think that similar mutations would affect both groups. A creature with very different genetics would be affected by the same mutating function in a different way.

We can find some mutations that we share, which would go to our genetic similarities, and some mutations we don't share, which would go to our genetic differences.

A plague that sweeps the globe like the Bubonic would possibly hammer the ape population in the same way as it hammered the human population, precisely because of our shared genetic designs.

[VadeRetro]

Tempo and Mode of Speciation, a lecture-notes slide show. A good primer on current theory.

If you still think hopeful monsters are part of the idea, please read before posting!

[f.Christian]

Perpetual evolution professor !

[Ichneumon]

LOL what you call "evidence" some would call redundant arguments of circular reasoning.

If "some" could make an actual case that circular reasoning was truly involved, I would admit that the observations should not count as supporting evidence.

Until then, however, unsupported labeling does not affect the validity of the evidence.

Abraham Lincoln: "If you call a tail a leg, how many legs does a dog have?"

Audience member: "Five."

Lincoln: "No, four. Calling a tail a leg doesn't make it one."

[Doctor Stochastic]

He believes the 6000 year time scale. His computations indicate a 150,000,000 scale. Cf. the White Queen.

[bondserv]

A word to the wise is sufficient.

[Doctor Stochastic]

C-G-C, B-Major, B-minor
C-G-C, B-minor, B-Major

Followed by a violin solo.

[Doctor Stochastic]

Is your definition of a "kind" the transitive closure of matable individuals?

[Michael_Michaelangelo]

Drosophila paulistorum? That's the FIRST example talkor*igins references as speciation in the link you posted? Sheeesh, that was refuted clear back in 1922! Joseph Boxhorn’s FAQ, titled Observed Instances of *Speciation* is still being tossed about by talkor*igins as fact!

New species are merely variations within species, or hybrids of the type similar to when horses and donkeys mate to produce mules. No new genetic information is created, and the supposed "new" species were examples like this one:

“5.3.1 Drosophila paulistorum. Dobzhansky and Pavlovsky (1971) reported a speciation event that occurred in a laboratory culture of Drosophila paulistorum sometime between 1958 and 1963. The culture was descended from a single inseminated female that was captured in the Llanos of Colombia. In 1958 this strain produced fertile hybrids when crossed with conspecifics of different strains from Orinocan. From 1963 onward crosses with Orinocan strains produced only sterile males. Initially no assortative mating or behavioral isolation was seen between the Llanos strain and the Orinocan strains. Later on Dobzhansky produced assortative mating (Dobzhansky 1972). "

These new species barely deserve commenting on. Dobshansky's "speciation right before our eyes" were still Drosophila, still fruit flies. They started out as fruit flies and they ended up as fruit flies and were, like many of Boxhorn's examples, sterile, thus having little or no value in evolutionary reproductive terms.

In another of Boxhorn’s experiments on fruit flies "55 virgin males and 55 virgin females of both ebony body mutant flies and vestigial wing mutant flies (220 flies total) were put into a jar and allowed to mate for 20 hours"! Whew! (Boxhorn did not personally carry out the experiment. I can imagine it would be a little hard on the eyes. How anyone figured out that they were virgins in the first place should have won a Nobel Prize) This experiment was done to examine the courtship behavior of mutant fruit flies, since Boxhorn believed that one of the distinctions of a species was determined by how attracted certain members of the opposite sex were to each other. Perhaps this meant that ugly fruit flies were of a different species than handsome ones.

The first two examples of speciation in Boxhorn’s FAQ were the experiments of de Vries (1905) and Digby (1912) on the Primrose plant, but as long ago as 1922 the magazine Science reported: "Twenty years ago de Vries made what looked like a promising attempt to supply this (evidence for new species appearing among natural offspring) as far as Oenothera [Primrose] is concerned . . .but in application to that phenomenon the theory of mutation falls. We see novel forms appearing, but they are no new species of Oenothera. For that which comes out is no new creation." (Science, Jan. 20, 1922; from an address by Professor William Bateson addressing a group of scientists in Toronto)

So talk.origins is still using an experiment for evidence for evolution that was rejected by the scientific community as long ago as 1922

From here: The Darwin Papers

[goodseedhomeschool (returned)]

Calling a tail a leg doesn't make it one

Those are the most illuminated words you have said.

[DittoJed2]

It is gruesomely naive to accept in the scientific realm which has never been observed. There are no "Missing links" because macro evolution can not occur. You have a few HIGHLY DISPUTED examples of what you say are macro evolution, but even most evolutionists will admit that the fossil record does not record the kind of information you would like for it to record.

[AndrewC]

Here is that Vitamin C data

TACCCCGTGGGGGTGCGCTTCACCCGGGGGGATGACAGCCGGCTGAGCCCC CONS 
--2-23--2-2-2-2--------2223223--2---2-22-2--------2 ALL/n
--+-++--+-+-+-+--------+++++++--+---+-++-+--------+ ALL

----++--------+---------+--+-+--+--------+--------- HUM/GP 
------------+-------------------------------------- HUM/CHIMP
----+---------+---------++----------+-------------- HUM/ORANG
--+-+---------+---------++++-----------+----------- HUM/MAC
----++----+------------+--++-+--+--------+--------- HUM/BOS
----++----+---+--------++--+-+--+--------+--------- HUM/PIG
----++--+-+---+---------+-++-+--------+--+--------- HUM/RAT


--------------+--------+--+--+--+-----------------+ BOS/MOUSE
-----+----+---+--------+--+------------------------ BOS/GP
--------------+-----------+-+---------------------- BOS/PIG
--------+-----+--------+--+--+--+-----+------------ BOS/RAT

"U238" that decays thrice, pretty good trick when there is "U238" that does not decay at all in 50,000,000 years.

[DittoJed2]

The specific "this is a man" element is missing from his make up.

Huh? What is a "man" element?
It is that part of a human being which makes him man. It is the part within man, be it genetic or some other unknown force (which I understand is a bit debated even after finding the human genome) that says from conception - this is going to be a human being. People today may produce hairy human beings but not apes. There is something within us that creates after our own kind. Science probably doesn't even understand "what", but that something gives us reasoning capability, speech, a conscience, and makes us uniquely human - setting us apart from the rest of God's creatures

. The difference between humans and apes (and as well as other mammals) is a difference in degree and not in kind.
Do you realize the implications of what you just said? I sure hope you are not pro-life. I sure hope that you make no moral judgments about anything anyone does, because with that kind of reasoning you have no leg to stand on. If we are no different than animals then what's wrong with killing us? How can ANY evolutionist say anything is wrong. By majority opinion? Well that's a beautiful world to live in.

I'm sure every geneticist you'll ask will confirm this.
Not those who accept God's authority and the Bible which says we are created in God's image and therefore are of much more value than animals.

No matter what variation in human population you see, a pigmy is still as much of a man as a North American scientist. You are not going to get the kind of change you are reaching for.

That's true, we are still pretty similar but you don't know that this can't happen if you keep the pigmies isolated long enough. Of course, since a human life span is pretty long this can take quite some time (my layman estimate would be some hundred thousands of years).
And you don't know that it could.

According to the hypothesis which said that they shared reproductive capability before.

Which hypothesis? I think even you will agree that the members of a population should be able to interbreed with each other. I mean these two groups were part of one population in the past.
The hypothesis that said two similar animals in different parts of the world were at one point, millions of years ago perhaps, part of the same species and were able to interbreed.

How long is 'long enough'?

Well, this can be thousands of years or even a few million. It depends a lot on the duration of a reproductive cycle as well as on the environmental stress on that particular population.
And that is a total guess. It's not happening today.

Assuming they were genetically fit to reproduce with the comparison species to begin with.
Not sure what you're meaning here.
An ape does not have the genetics to reproduce with a human. But one type of dog does have the genetics to reproduce with a totally different kind of dog.