Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

WikiLeaks founder says his next leak will virtually guarantee an indictment of Hillary [tr]
Silence is Consent ^ | July 22 2016 | Steve Boss

Posted on 07/22/2016 10:20:51 PM PDT by proust

WikiLeaks founder Julian Assange says his next leak will virtually guarantee an indictment of Hillary Clinton.

In a recent interview with ITV, Assange said the whistleblowing website will soon be leaking documents that will provide “enough evidence” for the Department of Justice to indict the presumptive Democratic nominee. WikiLeaks has already published 30,322 emails from Clinton’s private email server, spanning from June 30, 2010 to August 12, 2014. While Assange didn’t specify what exactly was in the emails, he did tell ITV that WikiLeaks had “accumulated a lot of material about Hillary Clinton, which could proceed to an indictment.”


TOPICS: Extended News
KEYWORDS: 2016demprimary; assange; clinton; dncemails; feelthebern; hacking; hillary; hillary2016; whistleblowers; wikileaks
Navigation: use the links below to view more comments.
first previous 1-20 ... 81-100101-120121-140 ... 161-171 next last
To: proust

He has said this all along.


101 posted on 07/23/2016 4:11:34 AM PDT by Bookwoman (No more Bushes or Clintons or RINOs"...and I am unanimous in this...")
[ Post Reply | Private Reply | To 1 | View Replies]

To: Enchante

...why difference does it make! :-)


102 posted on 07/23/2016 4:19:59 AM PDT by ThePatriotsFlag ( Anything FREELY-GIVEN by the government was TAKEN from someone else.)
[ Post Reply | Private Reply | To 24 | View Replies]

To: proust; All

Better to time it AFTER the DNC and PIAPS is the nominee. Preferably right before the first debate. Have the leak of material be the topic of discussion.


103 posted on 07/23/2016 4:53:00 AM PDT by HombreSecreto (The life of a repo man is always intense)
[ Post Reply | Private Reply | To 5 | View Replies]

To: Bullish
"This could be a world full of butt hurt for Hillary... And just when she was so close."

Good, lol.

104 posted on 07/23/2016 4:57:48 AM PDT by Mr Apple ( HILLARY CLINTON > COOKIES CHOCOLATES DESSERTS & CASHEWS.....the WALRUS LOOK)
[ Post Reply | Private Reply | To 19 | View Replies]

To: proust
Looks like he is timing it to hit during the DNC for maximum carnage. The recent release was pretty meaty.

I keep hearing about the leaks and the docs but don't see much of what they contain. Is there an index somewhere?

Anyone on FR dedicating themselves to posting some content on the subject?

105 posted on 07/23/2016 5:03:54 AM PDT by gunsequalfreedom
[ Post Reply | Private Reply | To 5 | View Replies]

To: proust

Oh PULLEEZE!!


106 posted on 07/23/2016 5:04:13 AM PDT by Ann Archy (Abortion....... The HUMAN Sacrifice to the god of Convenience.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: CivilWarBrewing

Hush!!!!..People may read that and put 2 and 2 together.../s


107 posted on 07/23/2016 5:05:50 AM PDT by M-cubed
[ Post Reply | Private Reply | To 14 | View Replies]

To: nutmeg

Thanks for posting that. It was kinda interesting. Hoping more will be posted. Suppose I’m going to have to find the link to all of them and do some reading. Thanks again.


108 posted on 07/23/2016 5:08:28 AM PDT by gunsequalfreedom
[ Post Reply | Private Reply | To 89 | View Replies]

To: proust

Enough evidence for a “reasonable” prosecutor to bring a case?


109 posted on 07/23/2016 5:09:26 AM PDT by kevao (Biblical Jesus: Give your money to the poor. Socialist Jesus: Give your neighbor's money to the poor)
[ Post Reply | Private Reply | To 1 | View Replies]

To: proust

If Julian Assange releases damaging information the day of her convention speech, I’d say he was a master showman.

But I know that’s just a lot of wishful thinking.


110 posted on 07/23/2016 5:11:03 AM PDT by CaptainK (...please make it stop. Shake a can of pennies at it.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: HombreSecreto; All

Ok, I give up. What does “PIAPS” mean? I’ve seen others use that in referring to Secty. Cankles but I’ve never been able to figure out what that acronym means.

Thanks in advance,


111 posted on 07/23/2016 5:11:27 AM PDT by FourtySeven (47)
[ Post Reply | Private Reply | To 103 | View Replies]

To: FourtySeven

Pig In A Pantsuit


112 posted on 07/23/2016 5:14:29 AM PDT by csvset ( Illegitimi non carborundum)
[ Post Reply | Private Reply | To 111 | View Replies]

To: proust

Bkmk


113 posted on 07/23/2016 5:16:10 AM PDT by novemberslady
[ Post Reply | Private Reply | To 1 | View Replies]

To: FourtySeven

No problemo - Pig In A Pants Suit


114 posted on 07/23/2016 5:28:01 AM PDT by HombreSecreto (The life of a repo man is always intense)
[ Post Reply | Private Reply | To 111 | View Replies]

To: ViLaLuz

Now now, be patient

Timing is everything and nobody gives a damn in August.


115 posted on 07/23/2016 5:29:31 AM PDT by bert ((K.E.; N.P.; GOPc;WASP ....Opabinia can teach us a lot)
[ Post Reply | Private Reply | To 2 | View Replies]

To: euram

After Labor Day

Nobody pays attention in August


116 posted on 07/23/2016 5:30:49 AM PDT by bert ((K.E.; N.P.; GOPc;WASP ....Opabinia can teach us a lot)
[ Post Reply | Private Reply | To 12 | View Replies]

To: gunsequalfreedom

Look on the sidebar.


117 posted on 07/23/2016 5:38:36 AM PDT by monkeywrench (Deut. 27:17 Cursed be he that rmemoveth his neighbor's landmark)
[ Post Reply | Private Reply | To 105 | View Replies]

To: proust
Obama will pardon her. Just like the Gov. of Virginia faced with the State Supreme Court ruling overturning his blanket restoration of voting rights for felons, has promised to hand-process clemency for all 200,000 of them.

There *is* an answer to this, but it's not pretty.

118 posted on 07/23/2016 5:39:53 AM PDT by grey_whiskers (The opinions are solely those of the author and are subject to change without notice.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: proust

Even if Ambassador Chris Stevens, who is gay, was wearing a blue evening gown when he was murdered, and even if Hillary’s DNA was on the fabric, proving she had a hand in his murder, an indictment is not going to happen. She’s a Clinton. Nothing, not even DNA evidence on a dress, is enough to convict her.


119 posted on 07/23/2016 5:49:04 AM PDT by Pollster1 (Somebody who agrees with me 80% of the time is a friend and ally, not a 20% traitor. - Ronald Reagan)
[ Post Reply | Private Reply | To 1 | View Replies]

To: proust; SunkenCiv; TigerLikesRooster
I can't stand Hillary but Russian — sorry “Wikileaks” — naked intervention in a US Presidential election ought to anger every American.

John Schindler
https://twitter.com/20committee/status/756821673916129280

Background: https://20committee.com/2016/07/02/the-kremlin-admits-snowden-is-a-russian-agent/

120 posted on 07/23/2016 5:55:41 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 81-100101-120121-140 ... 161-171 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson