Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

News Flash - Missiles raining down on Ghadaffi's compound!!!
FOX News ^ | 3-20-2011 | FOX Live

Posted on 03/20/2011 4:26:53 PM PDT by Stayfrosty

Just breaking on TV between Admiral John Stufflebeem and FOX News host

(Excerpt) Read more at foxnews.com ...


TOPICS: Breaking News; Front Page News; News/Current Events; War on Terror
KEYWORDS: 1worldgovernment; aerialassassins; assassinationattempt; assassins; deficit; ghadaffi; illegalwar; libya; nowarforoil; obama; oilwar; stufflebeem; tripoli; war
Navigation: use the links below to view more comments.
first previous 1-20 ... 201-220221-240241-260261-278 next last
To: MediaMole
Personally, I’d supply both sides and let them fight it out.

Been done: Persia, during the Peloponnesian Wars.

Others believe our good ol' USofA is replaying that role in the ME right now.

If so, the question becomes, "Who will rise to unify these unsettled states, unify the ME under one, cohesive banner, and become this century's Alexander The Great?"

In the face of that possibility the United States, as the one playing Persia in this production, would be first in line as Enemy #1 of this rising star.

Of a certainty, Israel would be #2, but this New Alexander will march to Jerusalem over the smoking corpse of Washington D.C. Once Israel's longtime friend and defender is taken out, Jerusalem will stand alone.

If it sounds Apocalyptic, it's because it IS.

We'll just have to keep watching to see how this gels.

241 posted on 03/20/2011 11:36:17 PM PDT by HKMk23 (It won't be "Justice" until wicked people fry.)
[ Post Reply | Private Reply | To 15 | View Replies]

To: PghBaldy
We truly are a lawless nation if we caqn just willy-nilly invade and kill at whim, with NO threat to the US at all.

Welcome to 21st Century America.

242 posted on 03/20/2011 11:55:40 PM PDT by Gondring (Paul Revere would have been flamed as a naysayer troll and told to go back to Boston.)
[ Post Reply | Private Reply | To 202 | View Replies]

To: Stayfrosty; gandalftb; Dog

USAF EC-130J STEEL 74 transmitting on 6877.0 kHz Libya 20 March 2011

http://audioboo.fm/boos/307814-usaf-ec-130j-steel-74-transmitting-on-6877-0-khz-libya-20-march-2011

For your own safety do not leave port!


243 posted on 03/21/2011 3:00:44 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Stayfrosty

“”We cannot stand idly by when a tyrant tells his people there will be no mercy,” Obama said in a statement from Brazil.

I recall a majority of our people pleading vociferously not to pass Obamacare, followed by pleas to repeal it after it was enacted. A tyrant has ignored these pleas, taking the position that he does not “want to re-fight the battles of the past two years.” I concur we cannot stand idly by when tyrants behave in this fashion.


244 posted on 03/21/2011 4:07:48 AM PDT by DrC
[ Post Reply | Private Reply | To 1 | View Replies]

To: gleeaikin
Had not heard about Pakistan. Thank You for the info.

Regarding Libya - This is turning PR wise quickly against our four nation coalition. Although, most of what has occurred is not a surprise. My personal opinion is still, involving ourselves in this fight was a mistake. Waiting now for more countries' rebels to start yelling for help.

On a side note, LOL, I am literally amazed that our nation is entering war on the side of rebels, when in our nations history rebels have always been the bad guys.

245 posted on 03/21/2011 5:27:38 AM PDT by no-to-illegals (Please God, Bless and Protect Our Men and Women in Uniform with Victory. Amen.)
[ Post Reply | Private Reply | To 240 | View Replies]

To: Stayfrosty

WE HAVE NO BUSINESS THERE!


246 posted on 03/21/2011 5:53:24 AM PDT by NCBraveheart ("oderint dum metuant"........Let them hate, as long as they fear.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Dallas59

I’m sure all of the left will violently protest this outrage! Oh wait, I forgot...use of force is only bad when a Republican president does it.


247 posted on 03/21/2011 5:55:29 AM PDT by Texan Tory
[ Post Reply | Private Reply | To 19 | View Replies]

To: Texan Tory

LIBYA: WEBSITE, GADDAFI’S SON KILLED BY A SUICIDE-BOMBER

(AGI) Tripoli - Khamis, Gaddafi’s sixth son, was reportedly killed by the injuries suffered in a suicide bombing on Saturday. A Libyan pilot deliberately crashed his jet against the Bab al-Azizia barracks. Hospitalized in the intensive care unit of a Tripoli hospital, he reportedly died a few hours later. The news was disclosed by the Algerian newspaper Shuruk, which echoes the Al-Manara Libyan opposition’s Website.
However, the news has not been confirmed by the regime’s media.

http://www.agi.it/english-version/world/elenco-notizie/201103211039-cro-ren1026-libya_website_gaddafi_s_son_killed_by_a_suicide_bomber


248 posted on 03/21/2011 6:04:51 AM PDT by sunmars
[ Post Reply | Private Reply | To 247 | View Replies]

To: NonValueAdded

Yes please.


249 posted on 03/21/2011 6:24:46 AM PDT by Straight Vermonter (Posting from deep behind the Maple Curtain)
[ Post Reply | Private Reply | To 30 | View Replies]

To: manc
This was supposed to be a no fly zone not an out and out war for crying out loud

Actually, after knocking down air defenses when establishing a no-fly zone, it is a good idea to go after command & control, which means the top guy in this case.

250 posted on 03/21/2011 6:37:15 AM PDT by JimRed (Excising a cancer before it kills us waters the Tree of Liberty! TERM LIMITS, NOW AND FOREVER!)
[ Post Reply | Private Reply | To 41 | View Replies]

To: Stayfrosty
For true democracy to spread throughout the middle east this brick wall had to be torn down.then Islam & islamic LAW & Sharia & all of the relgious institutions in that part of the world must be basically smashed and their power removed forever, aka REFORMATION.

To think otherwise is abject stupidity and none of that is going to happen.
Thinking like yours has been leading the Western world into a holocaust of epic proportions

251 posted on 03/21/2011 6:55:01 AM PDT by bill1952 (Choice is an illusion created between those with power - and those without)
[ Post Reply | Private Reply | To 28 | View Replies]

To: no-to-illegals

On a side note, LOL, I am literally amazed that our nation is entering war on the side of rebels, when in our nations history rebels have always been the bad guys.

Particularly since these rebels are the strident Islamics who would kill us in a moments notice.


252 posted on 03/21/2011 7:08:59 AM PDT by Chickensoup (Totalitarian Fascism is here, now.)
[ Post Reply | Private Reply | To 245 | View Replies]

To: Stayfrosty

Word is that he has just made an application to the court to legally change his name to Ronald Wilson Obama.


253 posted on 03/21/2011 7:23:18 AM PDT by doug from upland (Barack Hussein Obama - making Jimmy Carter look better every day)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Chickensoup
Amen ... it does appear such. I have been thinking about our nation's War Between the States, Civil War, or however it was so named, and remembering the North and South divides so recent in world history. The South never wins, but past leaders of America, in recent world history have chosen the South over the North (as in Korea, & Vietnam) and I sometimes wonder, do our leaders now think the South is right? I know they were and are, yet I best run away, even though typed (recent history) is a fact. Not looking for a rebellion or rebellious course in history this AM ... LOL

Dearest Yankee brethren, I make an apology for my southern ignorance.

I best correct something least I see trouble. The only supported rebels in our nation's history (at least in print) are the Revolutionary War rebels against England, and there are revisionists out there working on changing that.... LOL

254 posted on 03/21/2011 7:39:41 AM PDT by no-to-illegals (Please God, Bless and Protect Our Men and Women in Uniform with Victory. Amen.)
[ Post Reply | Private Reply | To 252 | View Replies]

To: TigersEye

If you don’t understand the multifaceted situation in Sudan, I can’t write a Primer here.

But, I’ll expand upon my previous policy position to say that there must also be an actual National Security interest before executing the bombings of which I speak. So, Yes to Sudan to contain virulent Islamism, and No to Congo, where tribal war also killed millions.


255 posted on 03/21/2011 9:51:14 AM PDT by Uncle Miltie (Allah sucks pig teat.)
[ Post Reply | Private Reply | To 215 | View Replies]

To: Vermont Lt
"The Caliphate will stretch from India to Spain. By the end of the year."

Either it already does (Pakistan through Morocco,) or it doesn't (India and Spain are and will be excluded).

If by "Caliphate" you mean a united Islam under a single political / religious leader(ship), then I'll take that bet. The Pakis hate the Persians hate the Arabs, the Egyptians feel superior, the Moroccans like their King, the Jordanian Kingdom will remain separate, Iraq won't join because it would first fall into a decade of civil war, etc.

256 posted on 03/21/2011 9:56:05 AM PDT by Uncle Miltie (Allah sucks pig teat.)
[ Post Reply | Private Reply | To 201 | View Replies]

To: Aleya2Fairlie

International Mob. Perfect.


257 posted on 03/21/2011 10:02:16 AM PDT by screaminsunshine (34 States)
[ Post Reply | Private Reply | To 155 | View Replies]

To: Recovering_Democrat

Knock three times?


258 posted on 03/21/2011 11:40:37 AM PDT by tallyhoe
[ Post Reply | Private Reply | To 143 | View Replies]

To: gleeaikin
"dropped 45 2,000lb bombs on Libya. I wonder where. Isn’t that what they call bunker busters?"
On the airfield at Misratah some 100 miles east of Tripoli.
At tricky question. Because there where bombs that where called bunker busters used years ago that weighted 2KT. But we today normally think of bunker busters to be GBU-28/BLU-113 smart guided bombs that weight well over 4,000 pounds. Following is but one site that will give you an idea what they look like Here.
So why this particular airfield? Because it is where many of the military aircraft take off from and land and has a number of hanger facilities cordoned off for military use rather then civilian traffic.
259 posted on 03/21/2011 12:17:42 PM PDT by Marine_Uncle (Honor must be earned....Duncan Hunter Sr. for POTUS.)
[ Post Reply | Private Reply | To 240 | View Replies]

To: Marine_Uncle; no-to-illegals; Ernest_at_the_Beach; SE Mom; Pan_Yan; All

Lovely sleek missile at the link, but what I really wanted to see was the hole. ;-) Here is the latest AOL News feed on the Libyan situation:

http://www.aolnews.com/2011/03/21/pentagon-gadhafi-forces-in-disarray-after-assault-on-libya/?ncid=webmail


260 posted on 03/21/2011 12:32:39 PM PDT by gleeaikin
[ Post Reply | Private Reply | To 259 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 201-220221-240241-260261-278 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson