Free Republic
Browse · Search
News/Activism
Topics · Post Article

We will reap what we have sown.
1 posted on 02/11/2011 1:54:00 PM PST by LowTaxesEqualsProsperity
[ Post Reply | Private Reply | View Replies ]


Navigation: use the links below to view more comments.
first 1-2021-30 next last
To: LowTaxesEqualsProsperity

After propping up a dictator against the will of the people in Egypt, I’d say we’re already reaping what we’ve sown.


2 posted on 02/11/2011 1:56:19 PM PST by Huck (one per-center)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: LowTaxesEqualsProsperity

When do you think he will be on 60 minutes? That would be too cool.


4 posted on 02/11/2011 2:00:06 PM PST by Vermont Lt (Don't taze my junk bro.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: LowTaxesEqualsProsperity

Day of rage in Bahrain tomorrow.

Yippie skippie, freedom to build the caliphate here we come.

((shudder))


7 posted on 02/11/2011 2:01:52 PM PST by cripplecreek (Remember the River Raisin! (look it up))
[ Post Reply | Private Reply | To 1 | View Replies ]

To: LowTaxesEqualsProsperity

Did anyone think they would live to see the day that overseas press is our credible news? In case anyone missed Obama’s savior sickening speech; the transcript and Baghdad Bob Gibb’s LAST press briefing at the link below.

http://www.nationaljournal.com/live-blog-mubarak-to-step-down-tonight-reports-say-20110210


8 posted on 02/11/2011 2:01:58 PM PST by Dubya-M-DeesWent2SyriaStupid! (Obama:If They Bring a Knife to the Fight, We Bring a Gun (the REAL Arizona instigator))
[ Post Reply | Private Reply | To 1 | View Replies ]

To: LowTaxesEqualsProsperity

“Ben-Eliezer said. “’They may be talking about democracy but they don’t know what they’re talking about and the result will be extremism and radical Islam,’” he quoted Mubarak as saying. “

Well yes. It’s what the Kenyan wants radical Islam or he is clueless.


9 posted on 02/11/2011 2:01:58 PM PST by Red Steel
[ Post Reply | Private Reply | To 1 | View Replies ]

To: LowTaxesEqualsProsperity

I think everyone in the ME: Arabs and Jews think Barack Hussein Obama is a dolt.

Well, I take that back: Hamas thinks he is awesome.


11 posted on 02/11/2011 2:02:24 PM PST by Recovering_Democrat
[ Post Reply | Private Reply | To 1 | View Replies ]

To: LowTaxesEqualsProsperity; gandalftb; G8 Diplomat

This will be a very deep change in the ME. On Monday we will see a big demonstration in Tehran and the wind of change will sweep away the dictatorships, and hopefully the middle class will take power.


14 posted on 02/11/2011 2:06:17 PM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: LowTaxesEqualsProsperity

...and “we” (our current administration) probably deserved them all.


15 posted on 02/11/2011 2:07:04 PM PST by madison10
[ Post Reply | Private Reply | To 1 | View Replies ]

To: LowTaxesEqualsProsperity
'We see the democracy the United States spearheaded in Iran and with Hamas, in Gaza, and that's the fate of the Middle East. ....They may be talking about democracy but they don't know what they're talking about and the result will be extremism and radical Islam,'" he quoted Mubarak as saying.

All true. Free elections in the Islamic world are viewed by most American politicians as major successes in and of themselves. But as we've seen, those free elections usually bring disasters. The strongman dictatorships aren't the problem; the PEOPLE (and their violent cult) are the problem. Hundreds of millions of crazed Mohammedans are the problem.

18 posted on 02/11/2011 2:11:20 PM PST by Mr. Mojo
[ Post Reply | Private Reply | To 1 | View Replies ]

To: LowTaxesEqualsProsperity

OBAMA is setting up a MUSLIM WORLD and they WON”T BE STOPPED AT VIENNA THIS TIME BECAUSE THEY WILL DESTROY THE VATICAN ALSO!


25 posted on 02/11/2011 2:16:58 PM PST by Ann Archy (Abortion is the Human Sacrifice to the god of Convenience.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: LowTaxesEqualsProsperity
We will reap what we have sown.

Sadly, I think you are correct. I simply don't feel that Mubarak was ever a threat to the US, Israel or any of our other allies. Unfortunately there is no upside to our efforts to overthrow him. If it works out for Egypt, they will never give the US credit for it, but if it goes badly in Egypt then our meddling will be used by Muslim extremists to stir up the next revolution. There are other dictators in the region worth overthrowing...but not Mubarak.

26 posted on 02/11/2011 2:17:41 PM PST by NRG1973
[ Post Reply | Private Reply | To 1 | View Replies ]

To: LowTaxesEqualsProsperity

Egypt jumping from the frying pan into the fire.


30 posted on 02/11/2011 2:20:27 PM PST by 353FMG
[ Post Reply | Private Reply | To 1 | View Replies ]

To: LowTaxesEqualsProsperity

Chilling.


35 posted on 02/11/2011 2:24:13 PM PST by Trust but Verify (Let's party like it's 1773!)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: LowTaxesEqualsProsperity
There is no such thing as "democracy" under Sharia Law.
39 posted on 02/11/2011 2:26:31 PM PST by E. Pluribus Unum ("If they bring a knife to the fight, we bring a gun." -- Barry Soetoro, June 11, 2008)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: LowTaxesEqualsProsperity

Bump


45 posted on 02/11/2011 2:34:09 PM PST by tutstar
[ Post Reply | Private Reply | To 1 | View Replies ]

To: dennisw; Cachelot; Nix 2; veronica; Catspaw; knighthawk; Alouette; Optimist; weikel; Lent; GregB; ..
Middle East and terrorism, occasional political and Jewish issues Ping List. High Volume

If you’d like to be on or off, please FR mail me.

..................

46 posted on 02/11/2011 2:34:14 PM PST by SJackson (In wine there is wisdom, In beer there is freedom, In water there is bacteria.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: LowTaxesEqualsProsperity

We shall reap what others have sown for if you and I had anything to say about the matter.
We would not stand back and wait to see what will happens but rather insist upon a guided path to Democracy.
Not a willy nilly (hope this works out) attitude that the Liberals always seem to think works - but never does.
Liberals never think that evil wins out over good intent - every time.
Unless your population understands the true difference between freedom and just turning over your future to others that might have other ideas on the subject.
Arabs are historically used to being told to do things and are not used to taking responsibility for anything. It is always their leaders who take responsibility and the citizens ultimately must do what they are told.


52 posted on 02/11/2011 2:44:22 PM PST by jongaltsr (It)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: LowTaxesEqualsProsperity

You know what they say:

“Better the Devil you know than the Devil you don’t ...”

Sure, Mubarak might have been a slimeball dictator, but he was the linchpin in keeping a lid on the Middle East. If the MB comes to power in Egypt, other nations [Saudi Arabia, Yemen, etc.] may also go - then theres REALLY gonna be a problem ...


57 posted on 02/11/2011 2:50:46 PM PST by Lmo56 (If ya wanna run with the big dawgs - ya gotta learn to piss in the tall grass ...</i><p>)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: LowTaxesEqualsProsperity
We definitely know what persuasion Obama is now. During the Iran revolts when tens of thousands of young people took to the streets against a cheating MUSLIM regime, Obama said "We have to let Iran decide Iran's affairs"

Same thing happens in Egypt but the MUSLIM roles reversed and Obama says "Change and Transition must be swift and orderly."

He is a dyed in the wool MUSLIM Kenyan, nothing more.

60 posted on 02/11/2011 2:52:15 PM PST by Gaffer
[ Post Reply | Private Reply | To 1 | View Replies ]

To: LowTaxesEqualsProsperity

Hosni Mubarak had harsh words for the United States and what he described as its misguided quest for democracy in the Middle East
_______________________________________________

Nana the Editor to the rescue...

Hosni Mubarak had harsh words for Barry Dunham-Soetoro and what he described as his misguided quest for democracy in the Middle East


61 posted on 02/11/2011 2:52:30 PM PST by Tennessee Nana
[ Post Reply | Private Reply | To 1 | View Replies ]


Navigation: use the links below to view more comments.
first 1-2021-30 next last

Free Republic
Browse · Search
News/Activism
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson