Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

Mubarak Slammed U.S. in Phone Call with Israeli MK Before Resignation
Haaretz ^ | 2/11/11 | Reuters

Posted on 02/11/2011 1:53:50 PM PST by LowTaxesEqualsProsperity

Hosni Mubarak had harsh words for the United States and what he described as its misguided quest for democracy in the Middle East in a telephone call with an Israeli lawmaker a day before he quit as Egypt's president. The legislator, former cabinet minister Benjamin Ben-Eliezer, said on TV Friday that he came away from the 20-minute conversation on Thursday with the feeling the 82-year-old leader realized "it was the end of the Mubarak era". "He had very tough things to say about the United States," said Ben-Eliezer, a member of the Labor Party who has held talks with Mubarak on numerous occasions while serving in various Israeli coalition governments. "He gave me a lesson in democracy and said: 'We see the democracy the United States spearheaded in Iran and with Hamas, in Gaza, and that's the fate of the Middle East,'" Ben-Eliezer said. "'They may be talking about democracy but they don't know what they're talking about and the result will be extremism and radical Islam,'" he quoted Mubarak as saying. U.S. support for pro-democracy elements in Iran has not led to regime change in the Islamic Republic, and Hamas, a group Washington considers to be a terrorist organization, won a 2006 Palestinian election promoted by the United States. Hamas seized control of the Gaza Strip in 2007 after a coalition government it formed with Western-backed Palestinian President Mahmoud Abbas collapsed in a power struggle. Ben-Eliezer said Mubarak expanded in the telephone call on "what he expects will happen in the Middle East after his fall". "He contended the snowball (of civil unrest) won't stop in Egypt and it wouldn't skip any Arab country in the Middle East and in the Gulf.

(Excerpt) Read more at haaretz.com ...


TOPICS: News/Current Events
KEYWORDS: breakingnewsabuse; duplicate; islamization; mubarak; notbreakingnews; obama; zero
Navigation: use the links below to view more comments.
first 1-2021-4041-6061-80 ... 121-125 next last
We will reap what we have sown.
1 posted on 02/11/2011 1:54:00 PM PST by LowTaxesEqualsProsperity
[ Post Reply | Private Reply | View Replies]

To: LowTaxesEqualsProsperity

After propping up a dictator against the will of the people in Egypt, I’d say we’re already reaping what we’ve sown.


2 posted on 02/11/2011 1:56:19 PM PST by Huck (one per-center)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Huck

Whether we prop them up or not, they always seem to end up with one anyhow.


3 posted on 02/11/2011 1:59:24 PM PST by edpc (It's Kräusened)
[ Post Reply | Private Reply | To 2 | View Replies]

To: LowTaxesEqualsProsperity

When do you think he will be on 60 minutes? That would be too cool.


4 posted on 02/11/2011 2:00:06 PM PST by Vermont Lt (Don't taze my junk bro.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: edpc

exactly
if anyone thinks that democracy will happen there and no Mb will take over then they really are more stupid than I first thought


5 posted on 02/11/2011 2:01:05 PM PST by manc (Shame on all who voted for the repeal of DADT, who supported it or never tried to stop it. Traitors)
[ Post Reply | Private Reply | To 3 | View Replies]

To: Huck

Various Administrations supported Mubarak fully since 1981. Then, two weeks ago, we suddenly discover he’s a dictator? We had information that an upheaval was coming last year.


6 posted on 02/11/2011 2:01:24 PM PST by popdonnelly (If Obama improves education, who'll vote for him?)
[ Post Reply | Private Reply | To 2 | View Replies]

To: LowTaxesEqualsProsperity

Day of rage in Bahrain tomorrow.

Yippie skippie, freedom to build the caliphate here we come.

((shudder))


7 posted on 02/11/2011 2:01:52 PM PST by cripplecreek (Remember the River Raisin! (look it up))
[ Post Reply | Private Reply | To 1 | View Replies]

To: LowTaxesEqualsProsperity

Did anyone think they would live to see the day that overseas press is our credible news? In case anyone missed Obama’s savior sickening speech; the transcript and Baghdad Bob Gibb’s LAST press briefing at the link below.

http://www.nationaljournal.com/live-blog-mubarak-to-step-down-tonight-reports-say-20110210


8 posted on 02/11/2011 2:01:58 PM PST by Dubya-M-DeesWent2SyriaStupid! (Obama:If They Bring a Knife to the Fight, We Bring a Gun (the REAL Arizona instigator))
[ Post Reply | Private Reply | To 1 | View Replies]

To: LowTaxesEqualsProsperity

“Ben-Eliezer said. “’They may be talking about democracy but they don’t know what they’re talking about and the result will be extremism and radical Islam,’” he quoted Mubarak as saying. “

Well yes. It’s what the Kenyan wants radical Islam or he is clueless.


9 posted on 02/11/2011 2:01:58 PM PST by Red Steel
[ Post Reply | Private Reply | To 1 | View Replies]

To: Huck

I hardly think we propped him up...

I fear Mubarak is right, at least in terms of Egypt going the way of Islamic extremism.


10 posted on 02/11/2011 2:02:01 PM PST by Chuzzlewit
[ Post Reply | Private Reply | To 2 | View Replies]

To: LowTaxesEqualsProsperity

I think everyone in the ME: Arabs and Jews think Barack Hussein Obama is a dolt.

Well, I take that back: Hamas thinks he is awesome.


11 posted on 02/11/2011 2:02:24 PM PST by Recovering_Democrat
[ Post Reply | Private Reply | To 1 | View Replies]

To: Huck

“Among the classical authors, the common opinion was that a democracy would eventually choose as a ruler a tyrant who promised them what they wanted. Then he would subject them to what he wanted. The American founders understood this problem, which is why they founded a republic, not a democracy.”

Rev. James V. Schall, S. J., teaches political science at Georgetown University.


12 posted on 02/11/2011 2:04:24 PM PST by blue-duncan
[ Post Reply | Private Reply | To 2 | View Replies]

To: manc
Wow look at Huck's post another pro Islamic terrorist marxist lover on FR. I think we need some clean up here like what we did with the Guilianibots and Romneybots. Can we have a zot of proCodePinkIslamistsMarxistsbots???

I will donate my entire paycheck if these tools get thrown off Free Republic. That is a guarantee.

13 posted on 02/11/2011 2:04:53 PM PST by Dengar01 (Go Blackhawks!!! Go Bulls!!!)
[ Post Reply | Private Reply | To 5 | View Replies]

To: LowTaxesEqualsProsperity; gandalftb; G8 Diplomat

This will be a very deep change in the ME. On Monday we will see a big demonstration in Tehran and the wind of change will sweep away the dictatorships, and hopefully the middle class will take power.


14 posted on 02/11/2011 2:06:17 PM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]

To: LowTaxesEqualsProsperity

...and “we” (our current administration) probably deserved them all.


15 posted on 02/11/2011 2:07:04 PM PST by madison10
[ Post Reply | Private Reply | To 1 | View Replies]

To: Huck

This is the same argument people like you said in the late 70’s when we had to get rid of the Shah of Iran. What replaced him were fun-loving muslim clerics who have done all they can to make friendly w/the U.S.


16 posted on 02/11/2011 2:09:58 PM PST by Son-Joshua (son-joshua)
[ Post Reply | Private Reply | To 2 | View Replies]

To: manc

I heard that power was transfered to the Military. I don’t think the Military is gonna take any shit from the MB.


17 posted on 02/11/2011 2:10:29 PM PST by guardian_of_liberty (We must bind the Government with the Chains of the Constitution...)
[ Post Reply | Private Reply | To 5 | View Replies]

To: LowTaxesEqualsProsperity
'We see the democracy the United States spearheaded in Iran and with Hamas, in Gaza, and that's the fate of the Middle East. ....They may be talking about democracy but they don't know what they're talking about and the result will be extremism and radical Islam,'" he quoted Mubarak as saying.

All true. Free elections in the Islamic world are viewed by most American politicians as major successes in and of themselves. But as we've seen, those free elections usually bring disasters. The strongman dictatorships aren't the problem; the PEOPLE (and their violent cult) are the problem. Hundreds of millions of crazed Mohammedans are the problem.

18 posted on 02/11/2011 2:11:20 PM PST by Mr. Mojo
[ Post Reply | Private Reply | To 1 | View Replies]

To: AdmSmith

Obama was thrilled today in his speech and did not mention mideast peace or Israel or any inkling that we must be careful at who is in power.

I just heard a report there are protesters in (was it Iran?) with signs saying DEATH TO AMERICA.


19 posted on 02/11/2011 2:11:40 PM PST by Dubya-M-DeesWent2SyriaStupid! (Obama:If They Bring a Knife to the Fight, We Bring a Gun (the REAL Arizona instigator))
[ Post Reply | Private Reply | To 14 | View Replies]

To: blue-duncan

Actually, they founded a confederacy, and then expanded its power later to a consolidated republic. Of course, the individual states were republican in form already. Anyway, didn’t the notion of “pure” democracy go out with the city-state? Nowadays when people say democracy, they merely mean the right to vote for the leaders of their choice.


20 posted on 02/11/2011 2:12:04 PM PST by Huck (one per-center)
[ Post Reply | Private Reply | To 12 | View Replies]


Navigation: use the links below to view more comments.
first 1-2021-4041-6061-80 ... 121-125 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson