Molecular machine may lead to new drugs to combat human diseases

Purdue University ^ | February 18, 2005 | Susan A. Steeves

[Michael_Michaelangelo]

WEST LAFAYETTE, Ind. – The crystallized form of a molecular machine that can cut and paste genetic material is revealing possible new paths for treating diseases such as some forms of cancer and opportunistic infections that plague HIV patients.

Purdue University researchers froze one of these molecular machines, which are chemical complexes known as a Group I intron, at mid-point in its work cycle. When frozen, crystallized introns reveal their structure and the sites at which they bind with various molecules to cause biochemical reactions. Scientists can use this knowledge to manipulate the intron to splice out malfunctioning genes, said Barbara Golden, associate professor of biochemistry. Normal genes then can take over without actually changing the genetic code.

The results of the Purdue study are published in the January issue of the journal Nature Structural and Molecular Biology.

"In terms of human health, Group I introns are interesting because they cause their own removal and also splice the ends of the surrounding RNA together, forming a functional gene," Golden said. "We can design introns and re-engineer them so they will do this to RNA in which we're interested."

Once thought of as genetic junk, introns are bits of DNA that can activate their own removal from RNA, which translates DNA's directions for gene behavior. Introns then splice the RNA back together. Scientists are just learning whether many DNA sequences previously believed to have no function actually may play specialized roles in cell behavior.

[js1138]

OK, it's unexplained. But I suspect you don't react this way to every unexplained phenomenon.

[AndrewC]

I should clarify something: It looks like the junk DNA they removed from the mice really is junk in the short term.

Okay let us get this straight. The "junk" we are talking about is highly conserved. How did they determine this? Why, humans have that "same" junk! Now we can't experiment on humans to determine the function of this highly conserved "junk" so the mouse was used. Voila, not much harm(if any apparent) was caused to the mouse. Now why would the human have the "same" highly conserved "junk"? Remember there is no reason to fix the mutating DNA portions if it is "junk".

This is from an MSNBC story on it. Mice still thrive after loss of ‘junk DNA’

The scientists compared the genome of the mouse and humans and identified regions to delete. Using molecular engineering, they snipped out DNA sequences in mice embryonic stem cells and generated a strain of mice with the abridged genome.

[AndrewC]

Your own link showed that there never was "the expectation" WRT introns.

Of course, but apparently not everyone here thinks so, that is why Dr. James Shapiro is belittled here.(I know he is not the author of the link on the introns, but you can read his article which I linked and see he is one of those who don't consider "junk" in the genome.)

[AndrewC]

OK, it's unexplained. But I suspect you don't react this way to every unexplained phenomenon.

UFO's and ghosts don't impact my thinking. Things coming from nothing or things exceeding the speed of light do.

[js1138]

Things coming from nothing is somewhat out of my league. Existence is a miracle, no doubt about it. It remains to be seen how much we can know about beginnings.

I am unaware of anything violating relativity, although science writers sometimes portray entanglement as a violation. My understanding is that it is not, but I suppose that is controversial.

Everything quantum is a mystery, although folks who work with it say it's quite regular and sane.

[AndrewC]

For example an atomic state which occurs in less than 1x10^-50 atoms is a near certainty to occur in the Earth alone, which contains far more than 1x10⁵⁰ atoms.

For the mathematically impaired.

ATOMS IN THE EARTH

The Arithmetic

---

(a) Total weight of the earth in pounds¹ = 1.3 x 10²⁵

---

(b) Average atomic weight of matter in the earth² = 40
(c) Grams in one pound = 453.592

---

(d) Average number of moles per pound of earth³ = (c) / (b) = 453.59/40 = 11.34

---

(e) Avogadro number⁴ = 6.02 x 10²³

---

(f) Atoms in all the earth⁵ = (a) x (d) x (e)⁶ = (1.3 x 10²⁵) x (11.34) x (6.02 x 10²³) = 88.745 x 10²⁵ x 10²³ = 88.745 x 10⁴⁸ = 8.87 x 10⁴⁹

---

Bottom line from the article ---It is extremely unlikely that the total number of atoms in the earth is higher than 10⁵¹ or lower than 10⁴⁸.

My calculations on the subject.

1 earth mass = 5.9742 × 10^24 kilograms
Proton mass = 1.67262158 × 10^-27 kilograms

(5.9742 × (10^24)) / (1.67262158 × (10^-27)) = 3.57175829 × 10⁵¹ protons or 35.7175829 × 10⁵⁰

Chlorine?

[jennyp]

Okay let us get this straight. The "junk" we are talking about is highly conserved. How did they determine this? Why, humans have that "same" junk!

I don't know about "highly conserved". If I read the abstract right, the sequences' similarities are at 70% to ours:

We deleted two large non-coding intervals, 1,511 kilobases and 845 kilobases in length, from the mouse genome. ... Together, the two deleted segments harbour 1,243 non-coding sequences conserved between humans and rodents (more than 100 base pairs, 70% identity).

I can't find a decent reference to a percentage similarity number for the mouse genome as a whole vs. ours, but 70% doesn't seem like it should be any higher than the overall mouse vs. human figure. I did run across an interesting statement in this article:

"If segments of the genomes of two different organisms have been conserved (meaning the sequences are the same in both) over the millions of years since those organisms diverged, then the DNA sequences within those segments probably encode important biological functions."

The search for functional DNA sequences that have been conserved between two different organisms across a large distance in evolution is the classical approach to comparative genomics that has been used to interpret the information in the human genome. In order for this technique to work, the conserved functional sequences have to stand out as distinct from the non-functional sequences that were not conserved. That degree of distinction requires the passage of time--lots of it--in order for mutations and the lack of selection pressures to cause the non-functional sequences in the two genomes to drift apart.

For example, mice and humans last shared a common ancestor about 75 million years ago, plenty of time for the non-functional sequences in their respective genomes to go their separate ways. Only about five-percent of the two genomes are conserved and it has been shown that most of the genes and regulatory sequences that have been discovered lie within these conserved DNA segments.

I suspect that the putative junk DNA regions they knocked out were in fact not highly conserved compared to coding regions.

[AndrewC]

Together, the two deleted segments harbour 1,243 non-coding sequences conserved between humans and rodents (more than 100 base pairs, 70% identity).

The point is that 1,243 sequences, each over 100 base pairs with 70% identity is a humongus conserved "area". There is something called expectation when sequences are compared by BLAST. I'm pretty sure the expectation for this is close to zero. This is what I got when I took a 110 base sequence from mus musculus cytochrome and compared it to homo sapiens.

 Score = 38.2 bits (19), Expect = 3.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 86     atgggccttcttgctcagt 104
              |||||||||||||||||||
Sbjct: 223143 atgggccttcttgctcagt 223161

The expectation is low but the percent identities are 100%

[jennyp]

The point is that 1,243 sequences, each over 100 base pairs with 70% identity is a humongus conserved "area". There is something called expectation when sequences are compared by BLAST. I'm pretty sure the expectation for this is close to zero. This is what I got when I took a 110 base sequence from mus musculus cytochrome and compared it to homo sapiens. ... The expectation is low but the percent identities are 100%

There are several errors with your logic.

1) From the BLAST FAQ page here's what they say about what "Expect" means:

Q: What is the Expect (E) value?

The Expect value (E) is a parameter that describes the number of hits one can "expect" to see just by chance when searching a database of a particular size. It decreases exponentially with the Score (S) that is assigned to a match between two sequences. Essentially, the E value describes the random background noise that exists for matches between sequences. For example, an E value of 1 assigned to a hit can be interpreted as meaning that in a database of the current size one might expect to see 1 match with a similar score simply by chance. This means that the lower the E-value, or the closer it is to "0" the more "significant" the match is. However, keep in mind that searches with short sequences, can be virtually indentical and have relatively high EValue. This is because the calculation of the E-value also takes into account the length of the Query sequence. This is because shorter sequences have a high probability of occurring in the database purely by chance. For more details please see the calculations in the BLAST Course.

The Expect value can also be used as a convenient way to create a significance threshold for reporting results. You can change the Expect value threshold on most main BLAST search pages. When the Expect value is increased from the default value of 10, a larger list with more low-scoring hits can be reported.

The E value has nothing at all to do with which species are being compared! It makes no judgements about how close two species' sequences "should" be to each other.

2) The cytochrome c gene, being an essential gene, should be highly conserved. I would expect a non-functional DNA stretch to be less homologous than the cytochrome c gene! And in fact it is: The knocked-out sequences were 70% homologous - a full 30 percent less than your example! Your example contradicts your argument.

3) Your claim was that the mice gene deserts were much more highly conserved WRT the homologous human gene deserts than we should expect if they were truly junk. You're making a judgement based on the average overall genetic distance between mice & man, not just one gene (I hope). And we still don't know what the "official" overall % figure is for that.

Pinging the only two people I know of who might know the real figures...

[js1138]

conservative placemarker

[jennyp]

Oops, I guess furball4paws is also a microbiologist. What say you re: meece's avg. genetic distance from humans vs. the genetic distance of their noncoding segments? And does Andrew's interpretation of his cytochrome c BLAST comparison make any sense to you?

[furball4paws]

"Now that we don't look upon these introns as genetic "junk" (where did that term originate, anyway?),"

It goes back to the old days when scientists first started to clone eucaryotic genes and they found these introns. They cloned them into bacteria that don't have introns. So they needed to get rid of the "junk" to get the genes expressed in bacteria. Then they found eucaryotic hosts for cloning eucaryotic genes and discovered that the introns were important, but "junk" still stuck.

Are "junk" bonds really "junk" - I don't think so and neither do millions of investors, but because from one frame of reference some were "junk" the name has stuck there also.

Americans like colorful language, unlike say British English. That's why American is so much more vibrant in finding new ways to say things that stick, even if they don't always make sense.

[furball4paws]

I'm sorry jennyp, this one's just too far outside my baliwick.

it's been a long time since I played in this pool.

[AndrewC]

There are several errors with your logic.

Well, if there were any, you didn't address them. First, I made no mention of It makes no judgements about how close two species' sequences "should" be to each other.".

Second, my example showed that a 110 base sequence comparison resulted in a match of only 19 bases. The resulting expectation was high(or not surprising) even though the 19 identities were 100%.

Finally it was not AndrewC that chose the sequences mentioned in the "junk" DNA study. That was done by comparison of the mouse and man genomes. They were alike between mouse and man. They were "conserved" between mouse and man. And they were not genes between mouse and man.

[jennyp]

OK, here are two references to the phylogenetic distance between Man and Mouse. First, the American Museum of Nat'l History site says that "humans and mice share 90% of our genes]".

They also give a figure of 98% similarity between us and chimps. Now, this is unclear exactly what they're saying - "share 90% of our genes"? Do they mean 27,000 human genes are identical to mouse genes, or do they mean that an average of 1 in every 10 letters throughout the coding part of the genome are different? Sheesh, science writers!

Well, here's a news article. It says

"About 99 percent of genes in humans have counterparts in the mouse," said Eric Lander, Director of the Whitehead Institute Center for Genomic Research in Cambridge, Massachusetts. "Eighty percent have identical, one-to-one counterparts."

Also:

Of course, there are also important differences. The mouse genome is about 14 percent smaller than the human version. ... But about 40 percent of the two genomes are directly aligned.

OK, with 80% of human genes being exactly equal to their mouse counterparts, and 19% of the rest of our genes having recognizable "counterparts" in the mouse, I think we can safely assume that the AMNH's figure of 90% must mean overall sequence similarity. At any rate, the overall sequence similarity figure must be somewhere higher than 80% if 80% of our genes are identical to the mouse versions.

Now, we go back to the gene desert knockout experiment. There they clearly said that the homology with the human sequence was only 70%. So yes, it did diverge more than the coding regions did. IOW, the junk DNA that they knocked out were not more highly conserved than the coding regions.

Nope, sorry Andrew, but it's junk. Or else the Designer is a packrat. :-)

[AndrewC]

Nope, sorry Andrew, but it's junk

Despite your declarations and smilies, the experiment was based on the sequence similarity in non-coding regions which was significant enough to be called conserved. Again, I did not find those regions, I did not excise those regions and I did not author a paper which brought gasps when the results were announced. The regions were conserved enough to warrant an attempt at observing what the result would be when they were removed. You have a complete misunderstanding on how these regions were selected. Sharing 90% of our genes merely means that, for example, mice and men might share the same gene for hair color, but mice have a gene for a certain musk where humans don't. That does not mean that the mouse hair gene and the human hair gene are a 100% sequence specific. It might mean that the genes themselves are 70% alike.

Homo sapiens cytochrome c oxidase subunit IV isoform 2 (lung), 
gene="COX4I2"

      
        1 cgttgctcgc tgggcagacc caggtcgcgc tcccactgcc gagcccgcga gatgctcccc
       61 agagctgcct ggagcttggt gctgaggaaa ggtggaggtg gaagacgagg gatgcacagc
      121 tcagaaggca ccacccgtgg tggggggaag atgtccccct acaccaactg ctatgcccag
      181 cgctactacc ccatgccaga agagcccttc tgcacagaac tcaacgctga ggagcaggcc
      241 ctgaaggaga aggagaaggg aagctggacc cagctgaccc acgccgaaaa ggtggccttg
      301 taccggctcc agttcaatga gacctttgcg gagatgaacc gtcgctccaa tgagtggaag
      361 acagtgatgg gttgtgtctt cttcttcatt ggattcgcag ctctggtgat ttggtggcag
      421 cgggtctacg tatttcctcc aaagccgatc accttgacgg acgagcggaa agcccagcag
      481 ctgcagcgca tgctggacat gaaggtgaat cctgtgcagg gcctggcctc ccgctgggac
      541 tatgagaaga agcagtggaa gaagtgactt gcatccccag ctgtctccct gaggctccgc
      601 cctggctggg agcctctggc ggcccctccc ctcccctgcc cttaacccca gtaaagctcc
      661 aaaaaaaaaa aaaaaa

This is the result of a BLAST seach on that sequence in the mouse genome. Notice that The query above is 676 bases in length. Below is the topmost result. Note that the comparison length is 402 with an 85% identities. That is a full 259 base shortfall. Yet this is a highly conserved gene.

>gi|29437300|gb|BC049623.1| Mus musculus cytochrome c oxidase subunit IV isoform 2, mRNA (cDNA
           clone MGC:58342 IMAGE:6532529), complete cds
          Length = 759

 Score =  321 bits (162), Expect = 1e-84
 Identities = 342/402 (85%)
 Strand = Plus / Plus

                                                                       
Query: 167 actgctatgcccagcgctactaccccatgccagaagagcccttctgcacagaactcaacg 226
           ||||||| |||||||||| ||| |||||||| || ||||||||||||||||| |||| ||
Sbjct: 180 actgctacgcccagcgctcctatcccatgccggatgagcccttctgcacagagctcagcg 239

                                                                       
Query: 227 ctgaggagcaggccctgaaggagaaggagaagggaagctggacccagctgacccacgccg 286
             ||| ||| ||||||||||||||| |||||||| |||||||||||||||| ||| || |
Sbjct: 240 aggagcagcgggccctgaaggagaaagagaagggcagctggacccagctgagccaagcag 299

                                                                       
Query: 287 aaaaggtggccttgtaccggctccagttcaatgagacctttgcggagatgaaccgtcgct 346
           | ||||||||||||||||||||||||||| |||| ||||| || |||||||||| |||||
Sbjct: 300 agaaggtggccttgtaccggctccagttccatgaaaccttcgcagagatgaaccatcgct 359

                                                                       
Query: 347 ccaatgagtggaagacagtgatgggttgtgtcttcttcttcattggattcgcagctctgg 406
           |||| || ||||||||||||||||| || ||||||||||||||||||||| | |||||||
Sbjct: 360 ccaacgaatggaagacagtgatgggctgcgtcttcttcttcattggattcacggctctgg 419

                                                                       
Query: 407 tgatttggtggcagcgggtctacgtatttcctccaaagccgatcaccttgacggacgagc 466
           |||||||||||||||| ||||| || || |||   |||    ||||| ||||||| || |
Sbjct: 420 tgatttggtggcagcgagtctatgtgttccctaagaaggttgtcaccctgacggaagaac 479

                                                                       
Query: 467 ggaaagcccagcagctgcagcgcatgctggacatgaaggtgaatcctgtgcagggcctgg 526
           |||||||||| ||||| |||||| | ||||||||||||   || ||  | ||||||||||
Sbjct: 480 ggaaagcccaacagctccagcgcctcctggacatgaagagcaaccccatacagggcctgg 539

                                                     
Query: 527 cctcccgctgggactatgagaagaagcagtggaagaagtgac 568
           |  ||| |||||| ||||| |||||| ||||||| |||||||
Sbjct: 540 ctgcccactgggattatgaaaagaaggagtggaaaaagtgac 581

Finally, you keep "putting words in my mouth" that I didn't say.

So yes, it did diverge more than the coding regions did. IOW, the junk DNA that they knocked out were not more highly conserved than the coding regions.

This is what I wrote.

Okay let us get this straight. The "junk" we are talking about is highly conserved. How did they determine this? Why, humans have that "same" junk! Now we can't experiment on humans to determine the function of this highly conserved "junk" so the mouse was used. Voila, not much harm(if any apparent) was caused to the mouse. Now why would the human have the "same" highly conserved "junk"? Remember there is no reason to fix the mutating DNA portions if it is "junk".

As you can see I made no comparison to coding regions, but I made this claim due to this article from "New Scientist".

Life goes on without 'vital' DNA

Virtually indistinguishable

To find out the function of some of these highly conserved non-protein-coding regions in mammals, Edward Rubin's team at the Lawrence Berkeley National Laboratory in California deleted two huge regions of junk DNA from mice containing nearly 1000 highly conserved sequences shared between human and mice.

[Right Wing Professor]

I'm away from my office at a funeral this week. I'll look into it when I get back. I ain't BLASTing from an internet cafe.

[jennyp]

Ah, sorry to hear that.

[jennyp]

As you can see I made no comparison to coding regions, but I made this claim due to this article from "New Scientist".

Life goes on without 'vital' DNA

Virtually indistinguishable

To find out the function of some of these highly conserved non-protein-coding regions in mammals, Edward Rubin's team at the Lawrence Berkeley National Laboratory in California deleted two huge regions of junk DNA from mice containing nearly 1000 highly conserved sequences shared between human and mice.

Ah, so that's where you get the notion that they were highly conserved. That's what I get for reading the actual abstract instead. :-)

OK, so the researchers considered the two stretches that they knocked out as highly conserved, but they say in the abstract that the similarity of the sequences is only 70%, while we've seen that the overall similarity between mice & man is closer to 90%. Apparently they thought the noncoding regions should have been even less similar than they in fact are. Yes, that's interesting.

Well now... Um, what was your point again? This was supposed to prove that evolutionists used to all think that junk was junk because of evolution (even though I showed that that's not true) and now they all are trying to argue that junk has a purpose because of evolution (even though the mouse experiment proves it's not true) and this makes evolution a just-so story?

Is the God of the Nits really hiding in there somewhere?

I'll let you have the last word...

[AndrewC]

Well now... Um, what was your point again?

Something you completely avoid. There is no reason for them to be conserved using RMNS explanation. The scientists knew this, and that is why they gasped when they heard the results of the actual "abstract" which you "intently" read and entirely missed the significance of.(It is very hard to put the audience's reaction into the paper they react to)