They also give a figure of 98% similarity between us and chimps. Now, this is unclear exactly what they're saying - "share 90% of our genes"? Do they mean 27,000 human genes are identical to mouse genes, or do they mean that an average of 1 in every 10 letters throughout the coding part of the genome are different? Sheesh, science writers!
Well, here's a news article. It says
"About 99 percent of genes in humans have counterparts in the mouse," said Eric Lander, Director of the Whitehead Institute Center for Genomic Research in Cambridge, Massachusetts. "Eighty percent have identical, one-to-one counterparts."Also:
Of course, there are also important differences. The mouse genome is about 14 percent smaller than the human version. ... But about 40 percent of the two genomes are directly aligned.OK, with 80% of human genes being exactly equal to their mouse counterparts, and 19% of the rest of our genes having recognizable "counterparts" in the mouse, I think we can safely assume that the AMNH's figure of 90% must mean overall sequence similarity. At any rate, the overall sequence similarity figure must be somewhere higher than 80% if 80% of our genes are identical to the mouse versions.
Now, we go back to the gene desert knockout experiment. There they clearly said that the homology with the human sequence was only 70%. So yes, it did diverge more than the coding regions did. IOW, the junk DNA that they knocked out were not more highly conserved than the coding regions.
Nope, sorry Andrew, but it's junk. Or else the Designer is a packrat. :-)
Despite your declarations and smilies, the experiment was based on the sequence similarity in non-coding regions which was significant enough to be called conserved. Again, I did not find those regions, I did not excise those regions and I did not author a paper which brought gasps when the results were announced. The regions were conserved enough to warrant an attempt at observing what the result would be when they were removed. You have a complete misunderstanding on how these regions were selected. Sharing 90% of our genes merely means that, for example, mice and men might share the same gene for hair color, but mice have a gene for a certain musk where humans don't. That does not mean that the mouse hair gene and the human hair gene are a 100% sequence specific. It might mean that the genes themselves are 70% alike.
Homo sapiens cytochrome c oxidase subunit IV isoform 2 (lung),
gene="COX4I2"
1 cgttgctcgc tgggcagacc caggtcgcgc tcccactgcc gagcccgcga gatgctcccc
61 agagctgcct ggagcttggt gctgaggaaa ggtggaggtg gaagacgagg gatgcacagc
121 tcagaaggca ccacccgtgg tggggggaag atgtccccct acaccaactg ctatgcccag
181 cgctactacc ccatgccaga agagcccttc tgcacagaac tcaacgctga ggagcaggcc
241 ctgaaggaga aggagaaggg aagctggacc cagctgaccc acgccgaaaa ggtggccttg
301 taccggctcc agttcaatga gacctttgcg gagatgaacc gtcgctccaa tgagtggaag
361 acagtgatgg gttgtgtctt cttcttcatt ggattcgcag ctctggtgat ttggtggcag
421 cgggtctacg tatttcctcc aaagccgatc accttgacgg acgagcggaa agcccagcag
481 ctgcagcgca tgctggacat gaaggtgaat cctgtgcagg gcctggcctc ccgctgggac
541 tatgagaaga agcagtggaa gaagtgactt gcatccccag ctgtctccct gaggctccgc
601 cctggctggg agcctctggc ggcccctccc ctcccctgcc cttaacccca gtaaagctcc
661 aaaaaaaaaa aaaaaa
This is the result of a BLAST seach on that sequence in the mouse genome. Notice that The query above is 676 bases in length. Below is the topmost result. Note that the comparison length is 402 with an 85% identities. That is a full 259 base shortfall. Yet this is a highly conserved gene.>gi|29437300|gb|BC049623.1| Mus musculus cytochrome c oxidase subunit IV isoform 2, mRNA (cDNA
clone MGC:58342 IMAGE:6532529), complete cds
Length = 759
Score = 321 bits (162), Expect = 1e-84
Identities = 342/402 (85%)
Strand = Plus / Plus
Query: 167 actgctatgcccagcgctactaccccatgccagaagagcccttctgcacagaactcaacg 226
||||||| |||||||||| ||| |||||||| || ||||||||||||||||| |||| ||
Sbjct: 180 actgctacgcccagcgctcctatcccatgccggatgagcccttctgcacagagctcagcg 239
Query: 227 ctgaggagcaggccctgaaggagaaggagaagggaagctggacccagctgacccacgccg 286
||| ||| ||||||||||||||| |||||||| |||||||||||||||| ||| || |
Sbjct: 240 aggagcagcgggccctgaaggagaaagagaagggcagctggacccagctgagccaagcag 299
Query: 287 aaaaggtggccttgtaccggctccagttcaatgagacctttgcggagatgaaccgtcgct 346
| ||||||||||||||||||||||||||| |||| ||||| || |||||||||| |||||
Sbjct: 300 agaaggtggccttgtaccggctccagttccatgaaaccttcgcagagatgaaccatcgct 359
Query: 347 ccaatgagtggaagacagtgatgggttgtgtcttcttcttcattggattcgcagctctgg 406
|||| || ||||||||||||||||| || ||||||||||||||||||||| | |||||||
Sbjct: 360 ccaacgaatggaagacagtgatgggctgcgtcttcttcttcattggattcacggctctgg 419
Query: 407 tgatttggtggcagcgggtctacgtatttcctccaaagccgatcaccttgacggacgagc 466
|||||||||||||||| ||||| || || ||| ||| ||||| ||||||| || |
Sbjct: 420 tgatttggtggcagcgagtctatgtgttccctaagaaggttgtcaccctgacggaagaac 479
Query: 467 ggaaagcccagcagctgcagcgcatgctggacatgaaggtgaatcctgtgcagggcctgg 526
|||||||||| ||||| |||||| | |||||||||||| || || | ||||||||||
Sbjct: 480 ggaaagcccaacagctccagcgcctcctggacatgaagagcaaccccatacagggcctgg 539
Query: 527 cctcccgctgggactatgagaagaagcagtggaagaagtgac 568
| ||| |||||| ||||| |||||| ||||||| |||||||
Sbjct: 540 ctgcccactgggattatgaaaagaaggagtggaaaaagtgac 581
Finally, you keep "putting words in my mouth" that I didn't say.
So yes, it did diverge more than the coding regions did. IOW, the junk DNA that they knocked out were not more highly conserved than the coding regions.
This is what I wrote.
Okay let us get this straight. The "junk" we are talking about is highly conserved. How did they determine this? Why, humans have that "same" junk! Now we can't experiment on humans to determine the function of this highly conserved "junk" so the mouse was used. Voila, not much harm(if any apparent) was caused to the mouse. Now why would the human have the "same" highly conserved "junk"? Remember there is no reason to fix the mutating DNA portions if it is "junk".
As you can see I made no comparison to coding regions, but I made this claim due to this article from "New Scientist".
Life goes on without 'vital' DNA