Despite your declarations and smilies, the experiment was based on the sequence similarity in non-coding regions which was significant enough to be called conserved. Again, I did not find those regions, I did not excise those regions and I did not author a paper which brought gasps when the results were announced. The regions were conserved enough to warrant an attempt at observing what the result would be when they were removed. You have a complete misunderstanding on how these regions were selected. Sharing 90% of our genes merely means that, for example, mice and men might share the same gene for hair color, but mice have a gene for a certain musk where humans don't. That does not mean that the mouse hair gene and the human hair gene are a 100% sequence specific. It might mean that the genes themselves are 70% alike.
Homo sapiens cytochrome c oxidase subunit IV isoform 2 (lung),
gene="COX4I2"
1 cgttgctcgc tgggcagacc caggtcgcgc tcccactgcc gagcccgcga gatgctcccc
61 agagctgcct ggagcttggt gctgaggaaa ggtggaggtg gaagacgagg gatgcacagc
121 tcagaaggca ccacccgtgg tggggggaag atgtccccct acaccaactg ctatgcccag
181 cgctactacc ccatgccaga agagcccttc tgcacagaac tcaacgctga ggagcaggcc
241 ctgaaggaga aggagaaggg aagctggacc cagctgaccc acgccgaaaa ggtggccttg
301 taccggctcc agttcaatga gacctttgcg gagatgaacc gtcgctccaa tgagtggaag
361 acagtgatgg gttgtgtctt cttcttcatt ggattcgcag ctctggtgat ttggtggcag
421 cgggtctacg tatttcctcc aaagccgatc accttgacgg acgagcggaa agcccagcag
481 ctgcagcgca tgctggacat gaaggtgaat cctgtgcagg gcctggcctc ccgctgggac
541 tatgagaaga agcagtggaa gaagtgactt gcatccccag ctgtctccct gaggctccgc
601 cctggctggg agcctctggc ggcccctccc ctcccctgcc cttaacccca gtaaagctcc
661 aaaaaaaaaa aaaaaa
This is the result of a BLAST seach on that sequence in the mouse genome. Notice that The query above is 676 bases in length. Below is the topmost result. Note that the comparison length is 402 with an 85% identities. That is a full 259 base shortfall. Yet this is a highly conserved gene.>gi|29437300|gb|BC049623.1| Mus musculus cytochrome c oxidase subunit IV isoform 2, mRNA (cDNA
clone MGC:58342 IMAGE:6532529), complete cds
Length = 759
Score = 321 bits (162), Expect = 1e-84
Identities = 342/402 (85%)
Strand = Plus / Plus
Query: 167 actgctatgcccagcgctactaccccatgccagaagagcccttctgcacagaactcaacg 226
||||||| |||||||||| ||| |||||||| || ||||||||||||||||| |||| ||
Sbjct: 180 actgctacgcccagcgctcctatcccatgccggatgagcccttctgcacagagctcagcg 239
Query: 227 ctgaggagcaggccctgaaggagaaggagaagggaagctggacccagctgacccacgccg 286
||| ||| ||||||||||||||| |||||||| |||||||||||||||| ||| || |
Sbjct: 240 aggagcagcgggccctgaaggagaaagagaagggcagctggacccagctgagccaagcag 299
Query: 287 aaaaggtggccttgtaccggctccagttcaatgagacctttgcggagatgaaccgtcgct 346
| ||||||||||||||||||||||||||| |||| ||||| || |||||||||| |||||
Sbjct: 300 agaaggtggccttgtaccggctccagttccatgaaaccttcgcagagatgaaccatcgct 359
Query: 347 ccaatgagtggaagacagtgatgggttgtgtcttcttcttcattggattcgcagctctgg 406
|||| || ||||||||||||||||| || ||||||||||||||||||||| | |||||||
Sbjct: 360 ccaacgaatggaagacagtgatgggctgcgtcttcttcttcattggattcacggctctgg 419
Query: 407 tgatttggtggcagcgggtctacgtatttcctccaaagccgatcaccttgacggacgagc 466
|||||||||||||||| ||||| || || ||| ||| ||||| ||||||| || |
Sbjct: 420 tgatttggtggcagcgagtctatgtgttccctaagaaggttgtcaccctgacggaagaac 479
Query: 467 ggaaagcccagcagctgcagcgcatgctggacatgaaggtgaatcctgtgcagggcctgg 526
|||||||||| ||||| |||||| | |||||||||||| || || | ||||||||||
Sbjct: 480 ggaaagcccaacagctccagcgcctcctggacatgaagagcaaccccatacagggcctgg 539
Query: 527 cctcccgctgggactatgagaagaagcagtggaagaagtgac 568
| ||| |||||| ||||| |||||| ||||||| |||||||
Sbjct: 540 ctgcccactgggattatgaaaagaaggagtggaaaaagtgac 581
Finally, you keep "putting words in my mouth" that I didn't say.
So yes, it did diverge more than the coding regions did. IOW, the junk DNA that they knocked out were not more highly conserved than the coding regions.
This is what I wrote.
Okay let us get this straight. The "junk" we are talking about is highly conserved. How did they determine this? Why, humans have that "same" junk! Now we can't experiment on humans to determine the function of this highly conserved "junk" so the mouse was used. Voila, not much harm(if any apparent) was caused to the mouse. Now why would the human have the "same" highly conserved "junk"? Remember there is no reason to fix the mutating DNA portions if it is "junk".
As you can see I made no comparison to coding regions, but I made this claim due to this article from "New Scientist".
Life goes on without 'vital' DNA
Ah, so that's where you get the notion that they were highly conserved. That's what I get for reading the actual abstract instead. :-)As you can see I made no comparison to coding regions, but I made this claim due to this article from "New Scientist".
Life goes on without 'vital' DNA
Virtually indistinguishable
To find out the function of some of these highly conserved non-protein-coding regions in mammals, Edward Rubin's team at the Lawrence Berkeley National Laboratory in California deleted two huge regions of junk DNA from mice containing nearly 1000 highly conserved sequences shared between human and mice.
OK, so the researchers considered the two stretches that they knocked out as highly conserved, but they say in the abstract that the similarity of the sequences is only 70%, while we've seen that the overall similarity between mice & man is closer to 90%. Apparently they thought the noncoding regions should have been even less similar than they in fact are. Yes, that's interesting.
Well now... Um, what was your point again? This was supposed to prove that evolutionists used to all think that junk was junk because of evolution (even though I showed that that's not true) and now they all are trying to argue that junk has a purpose because of evolution (even though the mouse experiment proves it's not true) and this makes evolution a just-so story?
Is the God of the Nits really hiding in there somewhere?
I'll let you have the last word...