COVID-19 Vaccine Injury - Treatments to Counter mRNA Spike Protein Damage

Epoch Health ^ | Oct 17 2022 | Marina Zhang

[Bob Ireland]

“Post-COVID-19 vaccines syndrome,” said Dr. Paul Marik, co-founder and Chief Science Officer of the Frontline COVID-19 Critical Care Alliance (FLCCC), on Oct. 15 at a conference in Orlando, Florida, aimed at education and sharing information on treating spike protein-induced health issues.

Marik and 15 other experts including pathologist Dr. Ryan Cole, FLCCC co-founder Dr. Pierre Kory, and Steve Kirsch, founder of the Vaccine Safety Research Foundation, presented their research and findings.
. . . . . . . . .

[semimojo]

My wife’s cardiologist is treating quite a few patients with damaged hearts from the vaxxine.

My question was about heart failure, which is a specific condition, the target of the drug in question, and the conspiracy theory laid out by the poster.

Do you have any information about HF caused by the vaccines?

[Cold Heart]

The information you seek is in VARES

[Bob Ireland]

(Nattokinase) - Very helpful. Thank you! :)

Did you notice if it could prove useful in micro clotting?

[Jane Long]

Especially under the Deaths column :-(

Plenty of serious heart issues/HF issues, as well.

Why would anyone, here, still defend these dangerous $hots??

Absolutely mind boggling.

They are likely lying CDC/BigPharma compensated plants.

[Bob Ireland]

***The information you seek is in VARES***

VAERS - Virus Adverse Effect Reporting System. :) The system had come under increased criticism, apparently for political reasons. (What a surprise in the present political atmosphere!) I think it is getting straightened out somewhat.

[semimojo]

The information you seek is in VARES

You obviously have no idea what VAERS is, let alone how to spell the acronym.

[devere]

Ivermectin killed people due to the delay of what? It is very clear that people died due to the suppression of using Ivermectin for covid treatment.

https://pierrekory.substack.com/p/the-miracle-not-heard-around-the
https://pierrekory.substack.com/p/the-miracle-not-heard-around-the-fe9
https://pierrekory.substack.com/p/the-miracle-not-heard-around-the-1ee

[Bob Ireland]

***Would Food Grade Diatomaceous Earth help rid the body of parasites found in the Covid-19 vaccine?***

Much posted on this in the ongoing thread. :)

[Jane Long]

The point wasn’t that the drug isn’t beneficial.

The point is how amazing it is to see so many heart drugs being advertised….including for heart failure….for young people (such as the young man in the commercial).

I’m seeing this, more and more, with these heart drugs, and, younger people. More than ever before. Even on billboards….now, promoting top “heart care”….for children’s hospitals. Unprecedented. :-(

[Bob Ireland]

***Ivermectin killed people due to the delay of what?***

My impression upon reading the comment is that it meant 'delay in administering ivermectin' - poorly stated. Since it was widely outlawed by expert politicians it was not 'delayed' - it was denied. It is still widely panned even though in India and some third world countries it saved literally millions of lives.

It is worth noting that, while ivermectin costs pennies comparatively, mRNA 'vaccines' made billions for their manufacturers; plus we now know that at least some govt bureaucrats were getting kick backs -legally- to the tune of heaven only knows how much ... not that that would have influenced any political decisions. /s

[Cold Heart]

I have dyslexia. I know what it is. You have obviously not checked VAERS and just want to be argumentative.

[Bob Ireland]

***VAERS***

I reported a severe drop in serum iron levels, especially fertitin. I mentioned that my PCP doctor and my hematologist did not agree but I wanted it on record in case more such cases were reported. In the following months those levels returned to normal. My PCP, who had originally disagreed with me, began to reconsider.

I did NOT report initially my loss of immunity to herpes zoster virus - shingles. I subsequently read an Israeli study - where a huge portion of the population got injected - that they documented various losses of both natural and acquired immunities -- AND the number one statistically was shingles! Then I reported it to VAERS. sigh

Now I wonder what other immunities I might have lost. grrrr

[Bob Ireland]

‘...especially ferritin’ !!!

[Steve Van Doorn]

said, "Could you point to where in that paper you see GP120 mentioned as being part of the SARS2 surface glycoprotein?"

I shouldn't have given the BLAST. Though i will give it a try.
What you do is first look at HIV-1 and compare it to SARS-Cov-2 the whole genome
On the Genome of HIV and click on "FASTA" on the upper left of page: Now look for
" ATGGCAGTATTTGTTCACAATT "
within this page of HIV-1
https://www.ncbi.nlm.nih.gov/nuccore/AF422215.1

Now go to the SARS-Cov-2 the whole genome on this page.
" ATGGCAGTTTTTGTACACAATT " which according to Luc Montagnier and jean-claude Perez is 91% homology (similarity)
https://www.ncbi.nlm.nih.gov/nuccore/LR757998.1#sequence_LR757998.1

Which according to Montagnier and Perez they cited this report which is an "Uncanny similarity of unique inserts in the 2019-nCoV spike protein to HIV-1 gp120 and Gag" Which are fragments of HIV
Here:
https://www.biorxiv.org/content/10.1101/2020.01.30.927871v1

To answer your question gp120 gene is the outer surface of the glycoprotein from HIV.

All found in this report from July 2020:
https://www.researchgate.net/publication/342926066_COVID-19_SARS_and_Bats_Coronaviruses_Genomes_Peculiar_Homologous_RNA_Sequences_Jean_Claude_perez_Luc_Montagnier

[Steve Van Doorn]

said, "Sequences that completely match (were not found )""
That is obfuscation you don't need a completely matched sequence. Especially when RaTG13(SARS) fragments where also also found in covid which RaTG13 does have a 100% match with HIV-1. This is again in Montagnier and Perez paper. You really should read it.

[Steve Van Doorn]

"We think it was her growing up in a family where everyone smoked, both parents and 4 siblings. Also the family lived in a basement apartment in Chicago where Radon is present."

That doesn't account for why it flared up now. Her immunity was weakened is likely the case.

[Steve Van Doorn]

CatHerd who said anything about "recommending" any products?
This is the second time you put words into my mouth I never said.

I will be very clear I do not recommend anything not even Vitamins.
I clearly said "(you) Might look into high dose melatonin"
I say what they do and how they effect you and point out reports on dosage. That is NOT recommendation.

I will report you the next time you put words into my mouth.

[rodguy911]

So glad you did this Bob it was direly needed.No telling how many people it will help as well.
We live in times where it may or may not be possible to trust doctors hard to say.
Any that are still suggesting that people get the bio-weapons shots are not trustworthy,IMHO. The info that has come out over the last two years should convince anyone that the shots truly are bio-weapons and should be banned 100%.

[rodguy911]

Ivermectin is a big one.,P.
I got mine direct from India,just ordered it,took a while but its cheap and readily avaliavlbe. Just go to the India mart site:

https://dir.indiamart.com/impcat/ivermectin.html

and there are endless providers.No telling what else they can get I never got into it.
Between Ivermectin from time to time,I use it as maintenance,D3—2,000 units— three a day,1,500 vit. C, good quality zinc and a multi vitamin, it's all I need.
Also, for me I don't do hard pills. They don't work as well with me. I use chewable stuff or close to it for most pills.

[rodguy911]

Shows what little you know! Many of the comments here come from endless searching of the web from Freepers who know what they are doing. There are excellent sources out there from brilliant doctors all over the web. Many of us have found them and use them in our posts. You should try it some time you might learn a little however I doubt it.