Free Republic
Browse · Search
General/Chat
Topics · Post Article


1 posted on 06/28/2019 5:19:41 PM PDT by BenLurkin
[ Post Reply | Private Reply | View Replies ]


To: BenLurkin

What Is the difference between orbital angular momentum and circular polarization?


2 posted on 06/28/2019 5:24:12 PM PDT by Nateman (If the left is not screaming, you are doing it wrong.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: BenLurkin

Put this into English for those of us that are interested but can’t understand a WORD, please. :)


3 posted on 06/28/2019 5:25:12 PM PDT by dp0622 (The Left should know if Trump is kicked out of office, it is WAR!)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: BenLurkin

They crossed the beams. I thought you weren’t supposed to do that:)


4 posted on 06/28/2019 5:26:05 PM PDT by Cold Heart
[ Post Reply | Private Reply | To 1 | View Replies ]

To: BenLurkin

Physics, need more physics
I couldn’t follow this new concept at all


7 posted on 06/28/2019 5:30:06 PM PDT by HangnJudge
[ Post Reply | Private Reply | To 1 | View Replies ]

To: BenLurkin
Something like this could be just the thing for the Iranians to notch up their terrorism.


8 posted on 06/28/2019 5:31:54 PM PDT by C210N (You can vote your way into Socialism; but, you have to shoot your way out of it.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: BenLurkin

The researchers suggest that it should be possible to use their technique to modulate the orbital angular momentum of light in ways very similar to modulating frequencies in communications equipment. This could lead to the development of novel devices that make use of manipulating extremely tiny materials.

...

I like to know about the possible applications.


16 posted on 06/28/2019 5:49:46 PM PDT by Moonman62 (Facts are racist.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: BenLurkin

> not only is it a newly discovered property of light, it is also one that has never even been predicted <

Wrong. I predicted all that years ago! Unfortunately all my notes were lost (along with all my guns) in a boating accident.


18 posted on 06/28/2019 5:51:33 PM PDT by Leaning Right (I have already previewed or do not wish to preview this composition.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: BenLurkin

Yeah, man, like I saw this at the Planetarium in Seattle.

Think they were playing Pink Floyd.

It was far out.


19 posted on 06/28/2019 5:57:13 PM PDT by blueunicorn6 ("A crack shot and a good dancer")
[ Post Reply | Private Reply | To 1 | View Replies ]

To: BenLurkin

Toxic white light?


27 posted on 06/28/2019 6:29:48 PM PDT by Gene Eric (Don't be a statist!)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: BenLurkin

> “The researchers promptly dubbed the new property self-torque—and not only is it a newly discovered property of light, it is also one that has never even been predicted.”

Oh what a bunch of moose droppings! Everyone knows Al Gore invented this to counter the polar vortex.


31 posted on 06/28/2019 6:59:20 PM PDT by Hostage (Article V)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: BenLurkin
they appear as doughnut-shaped

That sounds like a very ubiquitous property of everything having magnitude (not immediately overcome by accelerative convergence). With magnetism, one will find both the hypertrochoid pattern of a force divergence, its precession and its convergent return to an inertial plane, recognized as a vortex, all combining into what most people would term "a doughnut."

It's important to recognize that a photon is an imaginary construct. If one subscribes to Einstein's claimed duality thereof, that it is both a particle and wave, that person is simply wrong. A wave is a consequential property of space, a waveform perturbation of space. Neither does a light bulb emit particles, as if it were giving up its matter in some process. A light bulb sets up a waveform of ether perturbations that are carried along by the ether. Light "particles" are not whizzed along to be collected into the catcher's mitt of our retainae or cameras' CCDs. Retinae and CCDs do not need to be scraped off or shaken out after years of photonic particle accumulations. We and they are simply designed with sensitivity to ether perturbations.

If more of us spoke German "Spukhafte Wirkung," more would have an appropriate resistance to associating our reputations with such a spurious concept. (He was saying that this was "the work of ghosts." No, Albert, no ghosts are required here.)

Were you aware that Einstein, when Edison was considering him for a job gave Einstein a test, after which Edison said Einsten "failed."? Not just that he wasn't all that hot, "[he] failed." Despite Edison's wonderfully tenacious ingenuity and inventiveness, he couldn't hold a candle an incandescent light to the likes of Heavside, Buscovits, Dollard, Faraday, Russell, Maxwell or Steinmetz.

Nikola Tesla dubbed (and was echoed by several of his peers) that Einstein was a "fuzzy-haired idiot (alternately crack-pot)." C.P. Steinmetz observed that certain phenomena were in no way constrained by an asserted maximum speed of light. Many true scientists have observed that instantaneous action at a distance is real. (When our government allows access to its breadth of the knowledge base in this area, a security clearance is required. Now, why would that be?)

The article's described "self-torque" may well be the commonly-observed property of magnetism precession (as seen in the picture below) along with the paired principles of force divergence and accelerative convergence. These are seen to occur with all magnetic coherence. "[O]rbital angular momentum" has obviously not been seen for the first time in connection with the article.

Anyone who thinks in terms of photons manifesting a particle/wave duality is simply perpetuating (the plagiarist) Einstein's mindless misunderstandings. What Einstein codified as his General Relativity was largely "borrowed" from the Henri Poincaré disk model and the Lorentz Transform.

Einstein's being given a Nobel Prize was a distraction that was in actuality a propagandistic event. He was given a Nobel prize for observing something JJ Thompson had already observed, but Einstein's explanation for what he observed was incorrect as to its causality. Describing what one observes should properly be almost always understood as separable from credit for a proper explanation of what caused that which was observed.

Einstein and many of his followers would more properly be considered primarily mathematicians than physicists or scientists. Using entirely counter-intuitive "uncommon sense" (since his musings self-admittedly couldn't be made to jibe with common sense) the adored Richard Feynman admitted that some particles' existence was claimed to allow the equations to balance. The universe's behavior does not require uncommon sense or a calculator to make equations balance.

There is no proper duality between a need for both common sense and uncommon sense. We should have a better sense of shame and be more circumspect to realize how many times the slate of purported knowledge has had to be "wiped clean" when succeeding generations was forced to repair or jettison the misconstruances of previous generations.

In addition to his penchant for plagiarism, Einstein never invented anything, is responsible for zero percent of the world's electrical infrastructure, and has been the force around which generations of potentially brilliant minds have been forced to degrade themselves at the altar of perpetual academic regurgitation while untold billions have been wasted chasing quarks, muons, leptons, gluons, electrons, neutrinos, W and Z bosons, or a god particle dubbed Higgs Boson. "Moron" was already taken. The Deep State's bright minds at S4 are far better trained.

The particle cult does not truly understand what it calls a photon. A collection of observations should not be mistaken for understanding. That is even more readily seen in their assertion of the existence of virtual photons supposedly involved in magnetism. The doughnut and vortex of a magnet should instruct us that the only "straight lines" in the universe are those our limited minds reduce from our constrained understanding of time.

37 posted on 06/28/2019 8:00:48 PM PDT by rx (Truth Will Out!)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: BenLurkin

OK, I have afterburner singes on my scalp. It flew right over my head.

And I really tried to understand all this.


40 posted on 06/28/2019 8:59:59 PM PDT by Loud Mime (Liberalism: intolerance masquerading as tolerance)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: BenLurkin

The chick in the video is hot.


41 posted on 06/28/2019 9:09:01 PM PDT by BobL (I eat at McDonald's and shop at Walmart - I just don't tell anyone.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: BenLurkin

43 posted on 06/28/2019 9:24:36 PM PDT by Chode (Send bachelors, and come heavily armed!)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: BenLurkin

Wow! That is very interesting. Thank you for posting that article. It seems that we really don’t know squat.


51 posted on 06/29/2019 6:19:47 AM PDT by GingisK
[ Post Reply | Private Reply | To 1 | View Replies ]

To: BenLurkin

From the article: More recently, researchers have found that light can also be twisted, a property called angular momentum.

Hm - recently - this article is from 1940: On the current and the density of the electric charge, the energy, the linear momentum and the angular momentum of arbitrary fields
https://www.sciencedirect.com/science/article/pii/S003189144090091X


54 posted on 06/29/2019 7:31:48 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies ]

Free Republic
Browse · Search
General/Chat
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson