Free Republic
Browse · Search
General/Chat
Topics · Post Article

Skip to comments.

Mathematicians Are Making Major Breakthroughs In The Understanding Of Prime Numbers
businessinsider.com ^ | Nov. 21, 2013, 3:07 PM | Andy Kiersz

Posted on 11/23/2013 5:57:05 PM PST by BenLurkin

 Most mathematicians have a sense that the twin primes conjecture should be true — the positioning of the prime numbers appear to be more or less random, even though on average the gaps between primes get larger, and if one has an infinitely long list of random odd numbers, we should have an infinite collection of pairs in our list. If at some point, prime numbers are always more than two numbers away from each other, we have a non-random aspect to their distribution that goes against this intuition.

(Excerpt) Read more at businessinsider.com ...


TOPICS: Science
KEYWORDS: primenumbers; stringtheory
Navigation: use the links below to view more comments.
first previous 1-2021-4041-6061-75 last

>> If at some point, prime numbers are always more than two numbers away from each other, we have a non-random aspect to their distribution that goes against this intuition.

Gibberish.

This is not a property of prime numbers.


61 posted on 11/23/2013 10:52:59 PM PST by Gene Eric (Don't be a statist!)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Revolting cat!

http://www.johnspeedie.com/healy/Ooo-eee.wav


62 posted on 11/24/2013 6:07:05 AM PST by BenLurkin (This is not a statement of fact. It is either opinion or satire; or both.)
[ Post Reply | Private Reply | To 47 | View Replies]

To: DManA

'Bluetooth and Google Glasses Barbie,' LOL!

63 posted on 11/24/2013 9:03:13 AM PST by Diana in Wisconsin (I don't have 'Hobbies.' I'm developing a robust Post-Apocalyptic skill set...)
[ Post Reply | Private Reply | To 12 | View Replies]

To: latina4dubya

64 posted on 11/24/2013 9:09:22 AM PST by Diana in Wisconsin (I don't have 'Hobbies.' I'm developing a robust Post-Apocalyptic skill set...)
[ Post Reply | Private Reply | To 32 | View Replies]

To: BenLurkin

What if 6 turned out to be 9?


65 posted on 11/24/2013 9:09:54 AM PST by Walmartian (I'm their leader. Which way did they go?)
[ Post Reply | Private Reply | To 1 | View Replies]

To: BenLurkin
My favorite "prime".


66 posted on 11/24/2013 9:22:08 AM PST by Bratch
[ Post Reply | Private Reply | To 1 | View Replies]

To: BenLurkin
How complete of an understanding do you need to know that it goes on forever?

Cant I get a gov't grant for my studies?
67 posted on 11/24/2013 9:27:52 AM PST by Delta 21 (If you like your freedom, you can keep your freedom. Period.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Scrambler Bob

Moreover, almost every integer is very large.


68 posted on 11/24/2013 11:38:51 AM PST by Mmmike
[ Post Reply | Private Reply | To 10 | View Replies]

To: 6SJ7; AdmSmith; AFPhys; Arkinsaw; allmost; aristotleman; autumnraine; backwoods-engineer; ...

Thanks BenLurkin.


· List topics · post a topic · subscribe · Google ·

69 posted on 11/25/2013 11:35:17 PM PST by SunkenCiv (http://www.freerepublic.com/~mestamachine/)
[ Post Reply | Private Reply | View Replies]

To: BenLurkin
Why are some numbers prime and the rest, not? Oh, yeah, you can tell all those divisibility stories you like, but the truth is that they're members of a privileged class lording it over all the rest, white capitalist racist imperialist OPPRESSORS.

Prime numbers, bah. Those of us who understand truly advanced social theory don't need math.

70 posted on 11/25/2013 11:45:18 PM PST by Billthedrill
[ Post Reply | Private Reply | To 1 | View Replies]

To: Paladin2

One is the Loneliest Number


71 posted on 11/25/2013 11:51:20 PM PST by woofie
[ Post Reply | Private Reply | To 2 | View Replies]

To: Ramius

“Soda!”


72 posted on 11/26/2013 4:25:32 AM PST by onedoug
[ Post Reply | Private Reply | To 16 | View Replies]

To: BenLurkin; SunkenCiv

A very good non-technical article https://www.simonsfoundation.org/quanta/20131119-together-and-alone-closing-the-prime-gap/

and the meat is here http://terrytao.wordpress.com/2013/11/22/polymath8b-ii-optimising-the-variational-problem-and-the-sieve/


73 posted on 11/26/2013 4:28:13 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]

To: AdmSmith

Prime... meat... heh heh...

THanks AdmSmith.


74 posted on 11/26/2013 6:06:50 PM PST by SunkenCiv (http://www.freerepublic.com/~mestamachine/)
[ Post Reply | Private Reply | To 73 | View Replies]

To: SunkenCiv

lol!


75 posted on 11/27/2013 12:29:36 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 74 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-2021-4041-6061-75 last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
General/Chat
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson