Free Republic
Browse · Search
General/Chat
Topics · Post Article

Skip to comments.

Alzheimer's disease - a neurospirochetosis.
The Journal of NeuroInflamation ^ | August 4, 2011 | By Judith Miklossy, MD

Posted on 08/26/2011 1:12:38 PM PDT by Swordmaker

Alzheimer's disease - a neurospirochetosis. Analysis of the evidence following Koch's and Hill's criteria.

Judith Miklossy
Correspondence: Judith Miklossy judithmiklossy@bluewin.ch

Journal of Neuroinflammation 2011, 8:90 doi:10.1186/1742-2094-8-90

Published: 4 August 2011
Abstract (provisional)

It is established that chronic spirochetal infection can cause slowly progressive dementia, brain atrophy and amyloid deposition in late neurosyphilis. Recently it has been suggested that various types of spirochetes, in an analogous way to Treponema pallidum, could cause dementia and may be involved in the pathogenesis of Alzheimer's disease (AD). Here, we review all data available in the literature on the detection of spirochetes in AD and critically analyze the association and causal relationship between spirochetes and AD following established criteria of Koch and Hill. The results show a statistically significant association between spirochetes and AD (P = 1.5 x 10-17, OR = 20, 95% CI = 8-60, N = 247). When neutral techniques recognizing all types of spirochetes were used, or the highly prevalent periodontal pathogen Treponemas were analyzed, spirochetes were observed in the brain in more than 90% of AD cases. Borrelia burgdorferi was detected in the brain in 25.3% of AD cases analyzed and was 13 times more frequent in AD compared to controls. Periodontal pathogen Treponemas (T. pectinovorum, T. amylovorum, T. lecithinolyticum, T. maltophilum, T. medium, T. socranskii) and Borrelia burgdorferi were detected using species specific PCR and antibodies. Importantly, co-infection with several spirochetes occurs in AD. The pathological and biological hallmarks of AD were reproduced in vitro. The analysis of reviewed data following Koch's and Hill's postulates shows a probable causal relationship between neurospirochetosis and AD. Persisting inflammation and amyloid deposition initiated and sustained by chronic spirochetal infection form together with the various hypotheses suggested to play a role in the pathogenesis of AD a comprehensive entity. As suggested by Hill, once the probability of a causal relationship is established prompt action is needed. Support and attention should be given to this field of AD research. Spirochetal infection occurs years or decades before the manifestation of dementia. As adequate antibiotic and anti-inflammatory therapies are available, as in syphilis, one might prevent and eradicate dementia.

The complete article is available as a provisional PDF. The fully formatted PDF and HTML versions are in production.


TOPICS: Science
KEYWORDS: alzheimers; alzheimersdisease; bakingsoda; gumdisease; neurospirochetosis; sciencediscovery; spirochetalinfection; spirochetes
Navigation: use the links below to view more comments.
first previous 1-20 ... 241-260261-280281-300301-310 next last
To: Right-wing Librarian

>>“gum” paortions, and put a permanent brown stain where the top of the enamels meet the “gum” line.
My ^70,000 investment was ruined.
******************************************************
Corrected:

“gum” portions, and put a permanent brown stain where the top of the enamels meet the “gum” line.

My $70,000 investment was ruined.


281 posted on 06/08/2016 12:55:55 PM PDT by Right-wing Librarian
[ Post Reply | Private Reply | To 280 | View Replies]

To: Right-wing Librarian
I believe you posted this several years ago, and like a naive innocent, I believed you and ruined my teeth.

Before doing this, I verified with you that it would be safe to use on my whole mouth restoration set of teeth. You assured me it would be safe.

After one time, it took the enamel off my ceramic restoration, ate away at the “gum” portions, and put a permanent brown stain where the top of the enamels meet the “gum” line.

My ^70,000 investment was ruined.

Baking Soda (Sodium Bicarbonate) and Dakins Solution (a 20 to 1 dilute solution of 7% Sodium Hypochlorite NaOCl) cannot do what you claim happened. Neither of those substances can effect any ceramic restorations. Not at all. Sodium BiCarbonate has a Mohs hardness of only 2.5 while normal tooth enamel has a hardness of 5. Ceramic surfaces have a Mohs hardness of 5 to 7 depending on the material used. That is on the statement of one of the world's top dental implantologists who uses all manner of materials for restorations. This protocol is use for every implant patient we have with exactly those kind of restorations and even other using plastics. He has never seen either do any damage to any such restoration in over 40 years of practice.

I call BS on your post.

282 posted on 06/08/2016 1:04:29 PM PDT by Swordmaker (This tag line is a Microsoft insult free zone... but if the insults to Mac users continue..)
[ Post Reply | Private Reply | To 280 | View Replies]

To: Swordmaker

not baking soda, it was the bleach.
And it’s NOT BS. I live with my ruined teeth.


283 posted on 06/08/2016 1:08:00 PM PDT by Right-wing Librarian
[ Post Reply | Private Reply | To 282 | View Replies]

To: AdmSmith; AnonymousConservative; Berosus; Bockscar; cardinal4; ColdOne; Convert from ECUSA; ...
Thanks Swordmaker!

284 posted on 06/08/2016 1:24:57 PM PDT by SunkenCiv (I'll tell you what's wrong with society -- no one drinks from the skulls of their enemies anymore.)
[ Post Reply | Private Reply | View Replies]

To: Right-wing Librarian
not baking soda, it was the bleach.
And it’s NOT BS. I live with my ruined teeth.

Ceramic restorations do not have "enamel" surfaces. Only natural teeth have enamel surfaces and a 20 to 1 of 7% original Clorox Dakin's solution will not even touch that enamel much less any Ceramic, which is a hard, non-reactive, glassy substance which is used in CHEMICAL LABS to contain many very reactive chemicals including strong acids and bases. You could have used the Clorox full strength from the bottle on a denture and probably not harmed it, but I would not advise it.

Using an even STRONGER household bleach (9 to 1) solution is often recommended to disinfect dentures regardless of materials they are made of to kill any residual oral yeast infections.

Your stomach acid can be as high as Ph 1.5 and your dental restoration is designed to withstand you vomiting that level of acid and not being discolored or being damaged in situ by that level of acid being poured over it. I assure you the materials your restoration was made out of, unless your dentist was extremely incompetent, were well capable of withstanding a short bath of very dilute Sodium Hypochlorite. . . And in fact we're probably bathed in a stronger solution of it when they were manufactured to clean and disinfect them.

While full strength Dakin's Solution, a base, has a Ph of 10, according to manufacturers of commercial versions of it the solution does not even require a Materials Data Satety Sheet it is so innocuous.

"Dakin's Solution® is not considered a hazardous substance1; therefore a Material Safety Data Sheet is neither required nor available.
Please accept this information sheet as a substitute.

The Dakin's solution recommended in this article is only slightly stronger than the water you would encounter in a public swimming pool or a spa and in fact degrades within minutes to salt water.

Starting with the new 7% solution of NaOCl in water, the Clorox formulation, diluted by 24 water added to 1 Clorox, the resulting NaOCl is only a ~0.3% solution. That is extremely weak. . . It's even recommended as a mouthwash regardless of what appliances you have in your mouth.

Note this PDF on how to make Dakin's Solution from Ohio State University Medical Center, (it uses the old Clorox concentration of 5.25%), and mentions the use as a mouthwash.

Dental ceramics are not easily affected by chemicals, Right-wing Librarian. In fact, just silicate ceramics, the lowest and cheapest level ceramics that might be used, are really hard to chemically change:

Ceramics generally have good chemical resistance to weak acids and weak bases. However, very strong acids or strong bases tend to produce ion exchange reactions and dissolve the structures. HF is commonly used to intentionally etch ceramic surfaces composed of silicates. It is the F- ion that causes the actual damage. In dentistry, most 2-phase silica-based restorations are treated with 10% HF solutions to etch them. This produces different dissolution that creates micromechanical relief prior to micromechanical bonding.

HF is HydroFluoric Acid, the strongest acid known. We use it it to etch the surfaces of the ceramics so they can be chemically glued to each other or to the tooth surfaces. It is FAR stronger than the weak acids or bases you are claiming damaged your ceramic restorations. Most modern ceramic restorations use sapphire or alumina composite ceramics which are even more impervious to chemical reaction that these more silicate and cheaper versions.

So, I repeat, your claim is BS.

285 posted on 06/08/2016 2:36:11 PM PDT by Swordmaker (This tag line is a Microsoft insult free zone... but if the insults to Mac users continue..)
[ Post Reply | Private Reply | To 283 | View Replies]

To: Swordmaker

It is ceramic, of course. Enamel was the word I used to describe to the reader that the finishing polished surface was compromised. And I don’t care what kind of detailed explanations you post, it damaged my teeth in the manner I described.

I had my whole mouth restoration done by one of the world’s BEST prosthodontist in Fort Washington, Pa. Dr. Thomas Balshi. He was appalled to hear what had happened, when I called from Florida.

So spare me your explanations. I made my post to make sure that anyone considering what you suggest is made FULLY aware of what may result.

Readers: If you are considering taking this medical “suggestion”, I urge you to FIRST consult with your own medical professional.

If only I had consulted my professional medical provider BEFORE trusting what I read HERE at FR, I would have avoided that with which I am left.


286 posted on 06/08/2016 2:48:06 PM PDT by Right-wing Librarian
[ Post Reply | Private Reply | To 285 | View Replies]

To: Right-wing Librarian

Dr. Thomas Balshi, Prosthodontics Intermedica, Fort Washington, Pa.


287 posted on 06/08/2016 2:51:22 PM PDT by Right-wing Librarian
[ Post Reply | Private Reply | To 286 | View Replies]

To: Right-wing Librarian
The number of our patients is larger than the entire population of Ft. Washington, PA., Right-wing Librarian, and the doctor I am citing has far more alphabet soup behind his name than your "BEST prosthodontist" in that small town. He may be the "best" in a town of 5400, but our top dentist is one of 100 top implantologists in the world, and the best dentist in a city of over 300,000.

He has been a PROFESSOR of DENTISTRY at the University of California, San Francisco, School of Dentistry, and was also Adjunct Professor of Dental Materials at the University of Georgia. He has TAUGHT this subject.

I will put those credentials, expertise, and knowledge up against your claims of superiority for your small town dentist any day who brags about his involvement with one (1) commercial implant system, the Brånemark (a screw and post) system. Our implantologist knows and uses 37 implant systems and developed two of them. He was the keynote speaker at the National Implantology Conference in Mumbai, India, several years ago and next month he is leaving to be the invited speaker at the Italian Implant Organization's national conference in Venice, Italy.

Since your dentist most likely used Brånemark implants and other materials to restore your mouth, then they would most likely be made of Zirconia. That material is even MORE resistant to chemicals than other ceramics, being made of ZiO2, Zirconium Dioxide. The chemical resistance of which is tremendous. Using Zirconium Dioxide is also appropriately used in chemical manufacturing:

"Seals, Valves and Pump Impellers

The handling and transport of slurries and aggressive chemicals present a difficult materials problem. High temperatures and high pressure flow lead to highly reactive and abrasive conditions. The key properties which make zirconia a suitable material for this application are:

Yet you would have us believe your dentist placed Brånemark restorations in your mouth that would not hold up to a solution of strong chlorine swimming pool water, which is all Dakin's Solution at that concentration is? Highly absurd.

A couple of years ago, we had to redo a Brånemark implant from the ground up, because Brånemark had marketed and sold a line of 14K GOLD ALLOY screw implants which were installed by someone back in Pennsylvania in this guy's mouth for some huge amount of money. Over a short period of time, every single one of them but one had failed, worn down, broken off, or bent into uselessness. Gold is the WORST possible material from which to make an implant system, yet they did. We replaced it with Vitalium for half of what it had cost him including the revision surgery to repair the damage and remove the gold.

Jewelers will tell you that your Cubic Zirconium (the crystalline form of ZiO2) will not be harmed by swimming in a chlorinated water pool, but the metal it is mounted in might be if it is not noble metal or a resistant alloy.

Is YOUR system gold? Some Gold alloyed with copper will turn dark brown when exposed to Chlorine. . . but it has to be a LOT of copper in the alloy. Copper is also NOT a good implant metal, nor is it EVER recommended.

288 posted on 06/08/2016 6:24:22 PM PDT by Swordmaker (This tag line is a Microsoft insult free zone... but if the insults to Mac users continue..)
[ Post Reply | Private Reply | To 286 | View Replies]

To: Swordmaker

You put down Dr. Balshi, you do so at your own foolery.
He is WORLD RENOWNED, people fly in from all over the world for his procedures. He has a teaching institute, his own lab, scores of employees, etc. This is a wealthy prestigious area. I personally sat with many dentists while observing his procedure, asking amazing questions and hearing amazing answers. This man is not to be so casually dismissed. But go right ahead and respond to my comments with more disrespect. I DON’T CARE. It doesn’t change my experience with doing what you suggest.

I have CM’s. No gold. My prosthesis traveled to many places over the world to complete various stages, as it was cutting edge technology at the time they were made, years ago.

Again, you can keep on posting whatever you wish in defense of your dentist’s practice while putting down another’s practice. I DON’T CARE. It does NOT change what happened to my teeth!

I personally do not think you should be permitted to post medical advice (”suggestions”) on someone else’s site. It is litigiously risky for the site’s owner, but that is not my call to make.

My ONLY purpose in sharing my experience with what you suggest is for OTHER readers, to be very careful and check what you read on the internet with your own professional medical provider.

You want to keep coming back at me? Fine. You can never convince me because I look in the mirror every day and see what taking your “suggestion” has wrought on my teeth.

I’ve shared my experience for all to read, and that was my goal, to help FReepers with their decision-making in regard to this.

DONE!


289 posted on 06/08/2016 7:23:58 PM PDT by Right-wing Librarian
[ Post Reply | Private Reply | To 288 | View Replies]

To: Swordmaker

A notorious Alzheimer’s disease villain may also be a germ-busting superhero. Amyloid-beta gums up the brains of people with Alzheimer’s but also takes out dangerous brain invaders, scientists report May 25 in Science Translational Medicine.

The next step is to see whether pathogens are entombed in A-beta plaques in the human brain, Tanzi says. “Now it’s time to start looking for them in patients.” To start, he and colleagues have just begun a project to catalog the collection of microbes in healthy brains and brains with Alzheimer’s.

Finding a strong link between pathogens and Alzheimer’s could suggest new ways to prevent the disease, Tanzi says. Vaccines that fight infections, for instance, might be one way to prevent A-beta pileup.

https://www.sciencenews.org/article/alzheimer%E2%80%99s-culprit-may-fight-other-diseases

Despite the blood-brain barrier’s efforts to keep them out, microbes – including yeast, chlamydia, spirochetes and herpes – manage to infect the brain, as they do every other organ.

Tanzi, co-corresponding author Robert Moir and their team first started to wonder whether plaques might have an immune function when they noted structural similarities between beta-amyloid and other antimicrobial peptides, and had previously published in vitro data supporting the idea that beta-amyloid had a role in innate immunity.

In their current experiments, published in the May 27, 2016, issue of Science, the team showed that high levels of amyloid beta protected mice against brain infections with the bacterium Salmonella typhimurium, and transgenic roundworms expressing amyloid beta were less susceptible to fungal infections.
http://www.bioworld.com/content/amyloid-plaques-%E2%80%98entomb%E2%80%99-microbes-immune-defense-0


290 posted on 06/09/2016 12:16:19 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 226 | View Replies]

Ping


291 posted on 06/09/2016 12:28:55 AM PDT by misanthrope (Liberalism; it is not unthinking ignorance, it is malignant evil.)
[ Post Reply | Private Reply | To 290 | View Replies]

To: Swordmaker
You may be asking yourselves what was the Tooth Powder our ancestors used that was supplanted by toothpaste. Some of you may already know. It was essentially ordinary Baking Soda with a little bit of common table salt. The table salt is unnecessary!

Baking Soda has a FIVE SECOND kill time on bacteria! It's like dumping a load of poisonous rocks on the bug's heads! It is a mild abrasive that will also clean your teeth and leave your mouth smelling far fresher than toothpaste will! It's CHEAP! You probably have a box in your kitchen!

Brush your teeth with Arm and Hammer Baking Soda and floss it down into the gums—the nasty bugs LOVE to stay down in the gingeva. If you have bleeding gums, you have a superhighway for them to enter your blood stream! We have started giving each of our patients an 8oz. box of Arm & Hammer Baking Soda (we buy them for 47¢ each at WalMart by the case.

Good advice...

292 posted on 06/09/2016 8:06:48 AM PDT by GOPJ ("DHS Quietly Moving, Releasing Vanloads of Illegal Aliens Away from Border"-where's ABC, CBS, CNN???)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Right-wing Librarian
Right-wing, I did a Google search of your dentist after you named him. He does not have a large presence. The associations he belongs to are associated with Brånemark and no other implants. His own claims show he only talks about Brånemark implants. I called it as I saw it. He appears to know only one implant system, a screw implant, which is one of the oldest on the market. . . which he pushes.

He appears to be good at self-promotion. His lecturing citations appear to be all associated with appearing on behalf of Brånemark and are probably funded by them. His lectures are on the Brånemark implant system and his "The Institute For Facial Esthetics" he founded consists of him and includes members of his family as other officers and directors.

His citation in his CV on their website claiming being listed in the 2004, Dr. Balshi was selected to be in the book, “The Best Dentists in America.” It's one every dentist in the USA is offered for a mere $650 fee (which is negotiable when their salespeople call, they'll even go as low as $100 if you show any reluctance to buy! I know, I've taken the call several times.). For that fee you get a lovely wall plaque, a listing in the book, and a copy of the book. Whoopee. . . We decline it every year because it is worth nothing. It has even less value than any "Who's Who" book. Apparently Dr Balshi's office manager figured that out in 2005 and has also declined the "honor" for the subsequent twelve years.

As for "defending" our dentist's practice, we have placed over 700 complex implants and not a single one has discolored following what is a pretty standard protocol for defending against bacterial invasion for a post extruding through a gum that no longer has the natural gingival sulcus and its natural outward flow that makes the seal that exists around natural teeth. That normal protocol is the use of a diluted Dakin's Solution. The ONLY difference we have instituted here is to use it in healthy mouths to kill spirochetes which may have some other prosthetic devices such as crowns or, in your instance, reconstructions. Not a SINGLE device has ever discolor because of the use of such a dilute Dakin's Solution in over forty years of practice. None.

Yours is the first we've ever heard of, so I still call BS on it, or yours is not made of any kind of normal material used for such dental reconstructions. I've provided you commentary showing the chemical resistance of the materials that are normally used for dental reconstruction, against which you provide an anecdote. Anecdotes are NOT data. Material data is exactly that, data. Anecdotes are not. These materials are chosen for their strength and resistance to wear and chemical issues, especially discoloring. Your claim does not hold any water on this in our experience which is extensive. Titanium does not discolor, Vitalium does not discolor, Silver amalgum does not discolor (although it would never be used for implants), and even dental gold does not discolor. . . And certainly dental ceramics do not discolor nor come apart nor erode under such a mild dilution of Dakin's, as you claim. So what in the heck are your reconstructions made out of? Tissue paper?

I have factually described what I see on your dentist's website. . . he knows only one system of implants, the Brånemark brand, and he actively pushes that single form (a screw) implant system when there are far more modalities of implants. He seems to promote himself quite a bit, appearing on TV and promote his preferred brand, which tells me he's probably actively backed by that company.

Dr. Balshi is probably an excellent dentist, but he is limited by being captive to only one implant system. There are many more and they can offer better solutions to many pathologies than the limited Brånemark screw only system. He does list that he is a Diplomate of The American Board of Prosthodontics. Good for him.

Our top Implantologist is a Fellow of the American Academy of Implant Dentistry, a Fellow of the International College of Implantology, a Member of the American Association of Oral & Maxillofacial Surgeons, a Diplomat of the American Board of Oral Implantology / Implant Dentistry, and an Examiner for the California State Dental Board for I.V. Sedation. He has both studied and taught multiple implant modalities at:


293 posted on 06/09/2016 11:57:54 AM PDT by Swordmaker (This tag line is a Microsoft insult free zone... but if the insults to Mac users continue..)
[ Post Reply | Private Reply | To 289 | View Replies]

bkmk


294 posted on 06/09/2016 12:16:28 PM PDT by mad_as_he$$
[ Post Reply | Private Reply | To 293 | View Replies]

To: Swordmaker

If anyone knows anything about SELF-PROMOTION, it would be YOU.


295 posted on 06/09/2016 1:01:45 PM PDT by Right-wing Librarian
[ Post Reply | Private Reply | To 293 | View Replies]

To: AZLiberty

Thank you very much for alerting me to this thread.


296 posted on 06/10/2016 9:56:49 PM PDT by T-Bone Texan (Don't be a lone wolf. Form up small leaderlesss cells ASAP !)
[ Post Reply | Private Reply | To 292 | View Replies]

To: GOPJ

bkmk


297 posted on 10/13/2016 3:19:43 PM PDT by AllAmericanGirl44 (If you ain't the lead dog, the scenery never changes.)
[ Post Reply | Private Reply | To 292 | View Replies]

Bkmrk


298 posted on 10/13/2016 4:49:06 PM PDT by misanthrope (Liberalism; it is not unthinking ignorance, it is malignant evil.)
[ Post Reply | Private Reply | To 297 | View Replies]

To: Swordmaker

Bfl


299 posted on 11/23/2016 8:02:49 AM PST by goodnesswins (Say hello to President Trump)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Swordmaker

Swordy, any current updates on your research since this thread ended?


300 posted on 08/30/2018 9:31:52 AM PDT by aMorePerfectUnion
[ Post Reply | Private Reply | To 293 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 241-260261-280281-300301-310 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
General/Chat
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson