Free Republic
Browse · Search
General/Chat
Topics · Post Article

Skip to comments.

Ironclad link between red meat and cancer identified
New Atlas ^ | October 24, 2024 | Paul McClure

Posted on 10/29/2024 1:18:14 PM PDT by Red Badger

click here to read article


Navigation: use the links below to view more comments.
first previous 1-20 ... 41-6061-8081-100101-105 next last
To: mikelets456

“Knowing our stupid electorate they’ll run in fear from eating red meat-—the rest of us will enjoy an overabundance of red meat at a lower price.”

I used to agree with that, but the problem is that the political support for allowing us to eat meat will drop along with the meat eaters.


81 posted on 10/29/2024 5:25:55 PM PDT by BobL
[ Post Reply | Private Reply | To 16 | View Replies]

To: The Truth Will Make You Free

That is why I argued with the doctor and he agreed to reduce my statins from 20mg every day to 5 mg pills only on 3 days. Have not noticed any adverse side effects.

I am a believer in MINIMUM prescription pills.
I eat lots of frozen foods and restaurant food and order pizza delivery often, my blood pressure like to stay at 140/90 without Lisinopril. I use 10 mg Lisinopril minimum dose pills daily, and that keeps my BP at 130/80.

Again, real key to remain healthy is my daily moderate exercise. Today, I pressure washed my 2 car garage driveway. It took me 4 hours because it was full of black mold. Not too bad for a 84 year old dude.


82 posted on 10/29/2024 5:31:02 PM PDT by Bobbyvotes (I already voted by mail for Trump/Vance in 2024. Hope they win.)
[ Post Reply | Private Reply | To 65 | View Replies]

To: Harmless Teddy Bear

Haha, most zoo animals are over-weight, compared to those in the wild.


83 posted on 10/29/2024 5:32:38 PM PDT by Bobbyvotes (I already voted by mail for Trump/Vance in 2024. Hope they win.)
[ Post Reply | Private Reply | To 77 | View Replies]

To: Bobbyvotes
True.

Not having to fight for your food, or mate or shelter or anything else frankly does that.

But the ones in the Chinese Zoos are not just a bit on the pudgy side they are on the "oh those poor things" side.

It is really sad.

84 posted on 10/29/2024 5:36:02 PM PDT by Harmless Teddy Bear ( Not my circus. Not my monkeys. But I can pick out the clowns at 100 yards.)
[ Post Reply | Private Reply | To 83 | View Replies]

To: roving
Partly it is people living long enough and growing big enough to raise their chances of getting cancer.

Yeah, tall people have a twenty percent higher chance at getting cancer just because taller means you have more cells and having more cells means there is a greater chance something will go wonky.

Which might be why fat people tend to get cancer at a greater rate as well.

But cancer has been found in the bones of our very remote ancestors so it was always around.

85 posted on 10/29/2024 5:40:38 PM PDT by Harmless Teddy Bear ( Not my circus. Not my monkeys. But I can pick out the clowns at 100 yards.)
[ Post Reply | Private Reply | To 76 | View Replies]

To: Bobbyvotes

Good idea using a lower dosage and staying active. I’m about 15 years behind you, but still doing 50-mile bike rides.


86 posted on 10/29/2024 6:01:19 PM PDT by The Truth Will Make You Free ( )
[ Post Reply | Private Reply | To 82 | View Replies]

To: Red Badger

Don’t blame the beef for what the bun did!


87 posted on 10/29/2024 6:38:41 PM PDT by Ag88 (Fast is fine, but accuracy is final. - Wyatt Earp)
[ Post Reply | Private Reply | To 2 | View Replies]

To: Cold Heart

Overconsumption of red meat has to be a lot better for you than the vaxx.


They tell you what is actually good for you, by trying to stop you from consuming it.

Opposite also holds true (jabs, etc).


88 posted on 10/29/2024 6:44:52 PM PDT by Jane Long (Jesus is Lord!)
[ Post Reply | Private Reply | To 6 | View Replies]

To: Red Badger

If true, then I should be dead by now.


89 posted on 10/29/2024 8:47:50 PM PDT by Labyrinthos
[ Post Reply | Private Reply | To 1 | View Replies]

To: CTyank

No telomerase activators are approved currently for anti-aging purposes specifically because they might encourage malignancy and because so little research has been conducted on the topic.


90 posted on 10/29/2024 9:41:05 PM PDT by steve86 (Numquam accusatus, numquam ad curiam ibit, numquam ad carcerem™)
[ Post Reply | Private Reply | To 61 | View Replies]

To: steve86

Extracts from the astragalus plant are thought to have the potential to activate telomerase but the same question exists about the potential to stimulate cancer.


91 posted on 10/29/2024 9:48:58 PM PDT by steve86 (Numquam accusatus, numquam ad curiam ibit, numquam ad carcerem™)
[ Post Reply | Private Reply | To 90 | View Replies]

To: Bobbyvotes

Must have been very rough being a plains Indian...


92 posted on 10/29/2024 9:50:41 PM PDT by piasa (Attitude adjustments offered here free of charge)
[ Post Reply | Private Reply | To 5 | View Replies]

To: mikelets456

Who can even afford to overconsume red meat these days?


93 posted on 10/29/2024 9:51:49 PM PDT by piasa (Attitude adjustments offered here free of charge)
[ Post Reply | Private Reply | To 16 | View Replies]

To: Mr Rogers

If you cook 2 lobsters with your steak it nullifies cancer cells. But it must be smothered in butter and lemon juice to get the healing properties just right.


94 posted on 10/30/2024 5:17:43 AM PDT by Keyhopper (Indians had bad immigration laws)
[ Post Reply | Private Reply | To 7 | View Replies]

To: Red Badger

Seems largely non specific nonsense.

The article never states what excessive consumption looks like and it states the iron from red meat. Is that different than iron from a hundred other sources? I thought iron was iron.


95 posted on 10/30/2024 5:23:07 AM PDT by Fzob (“The Party told you to reject the evidence of your eyes and ears. It was their final, most essential)
[ Post Reply | Private Reply | To 2 | View Replies]

To: Man from Oz

Fascinating. I will indeed contact you.
I miss making a nice burger with chopped onion and celery I mix in, nice salt-free catsup from Fred Meyer/Kroger on top. No bun, I don’t eat wheat.


96 posted on 10/30/2024 5:55:39 PM PDT by Veto! (Kamalala Sucks Rocks)
[ Post Reply | Private Reply | To 66 | View Replies]

To: FrozenAssets

My parents both died younger than I am. My sister too.

I eat all the right organic fruits and veggies, weigh 112, and try to walk at least half a mile every day. Exercise, I understand, is the most important thing to increase longevity.


97 posted on 10/30/2024 6:01:54 PM PDT by Veto! (Kamalala Sucks Rocks)
[ Post Reply | Private Reply | To 63 | View Replies]

To: Openurmind

My maternal greatgrandparents came from Ireland, so of course I eat potatoes.My beloved grandmother, who lived in New Orleans, called then “badaydahs” I buy organic potatoes. Every grocery store in my ‘hood has them: Safeway, Trader Joe, Natural Grocer, Fred Meyer/Kroger.

No big deal to find them elsewhere. I scrub them, cut them in half and steam them. Steaming is the easiest way to cook them and it preserves the most nutritional value. I steam veggies too.

You can fine little steamer inserts for pots at many grocery stores and, of course, at AMZ. Really cheap and they last forever.


98 posted on 10/30/2024 6:13:59 PM PDT by Veto! (Kamalala Sucks Rocks)
[ Post Reply | Private Reply | To 54 | View Replies]

To: Red Badger

https://www.medchemexpress.com/SP2509.html

https://pmc.ncbi.nlm.nih.gov/articles/PMC11450372/

https://pmc.ncbi.nlm.nih.gov/articles/PMC8610793/

https://en.wikipedia.org/wiki/PIR_(gene)

check later

99 posted on 11/02/2024 8:50:25 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Cold Heart

Or having iron-deficiency anemia.


100 posted on 11/02/2024 8:53:16 AM PDT by 9YearLurker
[ Post Reply | Private Reply | To 6 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 41-6061-8081-100101-105 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
General/Chat
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson