Free Republic
Browse · Search
General/Chat
Topics · Post Article

Skip to comments.

Iranian Regime tv Channel One hacked while it was airing Khamenie speech
various | 10-8-22

Posted on 10/08/2022 1:05:38 PM PDT by nuconvert

Iranian Regime national tv Channel One hacked about an hour ago. During a broadcast of Khamenie speech, a red crosshair appeared over his face and chanting of Women. Life. Freedom. There was writing to the side saying "Rise up. Join us". Also 4 photos at the bottom of the screen of young people killed and additional writing: "The blood of our youth is dropping from your paws".

Also, there was a huge banner in the middle of Tehran highway today that read: We are no longer afraid of you. We will fight.

Also, attempted attack on IRI ambassador in Denmark. Her bodyguard was stabbed. Diplomatic Security intervened before the attacker could stab the ambassador.


TOPICS:
KEYWORDS: basij; deathtothemullahs; denmark; ebrahimrigi; erdogan; iran; iranprotests; iraq; irgc; iri; israel; khameini; khamenei; kurdistan; lebanon; mahsaamini; mullahloversonfr; mullahsmustbekilled; najisharifizindashti; protests; qudsforce; raisi; receptayyiperdogan; shahrammaroufmola; syria; turkey; yemen; zahedi
Navigation: use the links below to view more comments.
first previous 1-20 ... 2,041-2,0602,061-2,0802,081-2,100 ... 2,281-2,293 next last

New FT reporting: Iran’s IRGC used a company in Ras al Khaimah (UAE) to procure roughly 1.8 tonnes of Chinese-made satellite antenna equipment. Route: Shanghai → Dubai → Iran.

This is a clear signal of architecture in Iran’s military space capabilities. The company: Telesun, based in Ras al Khaimah free zone. It arranged the shipment of Chinese satellite antennas from Shanghai, routed through Dubai. End-user: IRGC Aerospace Force (military), not Iran’s civilian space program.

https://x.com/thetect0nic/status/2058413091369468217


2,061 posted on 05/24/2026 3:29:03 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 2060 | View Replies]

To: AdmSmith

2,062 posted on 05/24/2026 4:47:43 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 2060 | View Replies]

To: PIF

Mossad Commentary
@MOSSADil
·
43m
This will be your legacy.
Capitulation.
Kicking the can.
Weak.
All talk.


2,063 posted on 05/24/2026 4:56:29 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 2062 | View Replies]

To: PIF

2,064 posted on 05/24/2026 5:01:16 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 2063 | View Replies]

To: PIF

The Hormuz Letter
@HormuzLetter
·
43m
BREAKING: Iran directly rejects Trump’s claim that Hormuz “will be opened” as part of a “largely negotiated” agreement he just posted on Truth Social, saying Trump’s claim is “far from the truth” and that Hormuz “will remain under Iranian management” with Iran retaining exclusive permanent authority over route, timing, method, and permits, per Fars.

Iran also confirms the nuclear file has not been discussed and that American officials themselves have told Iran in multiple messages that “Trump’s tweets are primarily for domestic American propaganda and media consumption” and “should be disregarded.” The “largely negotiated” deal claim therefore has no basis.


2,065 posted on 05/24/2026 5:04:43 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 2064 | View Replies]

To: PIF

2,066 posted on 05/24/2026 5:12:13 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 2065 | View Replies]

To: nuconvert

That’s from 2022 and the video was pulled. (The screenshot from the video is from 2022 also.)


2,067 posted on 05/24/2026 5:22:17 AM PDT by usconservative (When The Ballot Box No Longer Counts, The Ammunition Box Does. (What's In Your Ammo Box?))
[ Post Reply | Private Reply | To 7 | View Replies]

To: AdmSmith

Right now, the leaks about the latest deal sound like exactly that. Opening the strait with nuke negotiations to continue for another 30 to 60 days. I’m at a loss for words...


2,068 posted on 05/24/2026 6:51:16 AM PDT by nuconvert ( Warning: Accused of being a radical militarist. Approach with caution.)
[ Post Reply | Private Reply | To 2060 | View Replies]

To: nuconvert

This could just be about this week’s Hajj in Saudi Arabia, and making sure nothing happens during it.

Once it’s over, we’ll see what happens.


2,069 posted on 05/24/2026 6:52:44 AM PDT by dfwgator ("I am Charlie Kirk!")
[ Post Reply | Private Reply | To 2068 | View Replies]

To: dfwgator

I thought of that. I hope to hell that’s it and bombing continues right after.


2,070 posted on 05/24/2026 6:57:41 AM PDT by nuconvert ( Warning: Accused of being a radical militarist. Approach with caution.)
[ Post Reply | Private Reply | To 2069 | View Replies]

To: nuconvert

I never said that the U.S. lost. The U.S. militarily won but so far has failed to turn that into a strategic victory. A bad deal will effectively turn the whole thing into a net strategic loss.

Doesn’t mean that Iran has not been damaged significantly. But without a strategic victory to cement the military gains, that will become irrelevant in the mid term because Iran will recover from it sooner than most think.

https://x.com/Natsecjeff/status/2058555292011671672


2,071 posted on 05/24/2026 9:27:12 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 2070 | View Replies]

To: PIF

THIS 😂😂

https://x.com/_A_khalifa/status/2058582973369536575


2,072 posted on 05/24/2026 9:33:15 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 2065 | View Replies]

General Petraeus: We May Have to Go Back to War with Iran
23MAY2026 Gen. David Petraeus, former Director of the Central Intelligence Agency and former Commander of US Central Command, sits down with David Gura on Bloomberg This Weekend for a wide-ranging conversation.
https://www.youtube.com/watch?v=KmVy9ztIeMA


2,073 posted on 05/24/2026 11:15:15 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 2072 | View Replies]

To: AdmSmith

“I never said that the U.S. lost.”
?? I didn’t say you did.


2,074 posted on 05/24/2026 12:32:55 PM PDT by nuconvert ( Warning: Accused of being a radical militarist. Approach with caution.)
[ Post Reply | Private Reply | To 2071 | View Replies]

To: nuconvert

That was what Jeff (Natsecjeff) said.

xxxxxxxxxxxxxxxxxxxx

Iran is currently holding military drills near Hormuz....
https://x.com/Natsecjeff/status/2058633357286621541


2,075 posted on 05/24/2026 1:04:37 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 2074 | View Replies]

To: AdmSmith

2,076 posted on 05/24/2026 1:16:56 PM PDT by newfreep ("There is no race problem...just a problem race")
[ Post Reply | Private Reply | To 2075 | View Replies]

To: newfreep; nuconvert; PIF

No one is sleeping in the Middle East right now.


2,077 posted on 05/24/2026 1:33:48 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 2076 | View Replies]

Over the last 24 hours there appears to have been a slow awakening and realization inside the administration of what is real and what is fake.

Iran is not willing to compromise because they don’t feel defeated. All the rest is noise and nonsense.

https://x.com/mindjitsu/status/2058645191066562870


2,078 posted on 05/24/2026 2:10:11 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 2077 | View Replies]

Iran Update Special Report, May 24, 2026

Conflicting US, Iranian, and regional reporting indicates that the contours of a possible US-Iran memorandum of understanding (MOU) remain unresolved and may not yet represent a final agreement. US President Donald Trump stated on May 23 that a deal to end the war had been “largely negotiated” and awaited finalization.[1] A senior US official stated in a briefing with reporters on May 24 that the White House does not expect an agreement on May 24 and believes Iranian leadership, including Supreme Leader Mojtaba Khamenei, may need several days to approve the deal.[2] An unspecified senior US official told Axios that the United States is in a “very good place” but that the parties are still negotiating specific language and that “whether this becomes an agreement is still an open question.”[3] Trump separately stated on May 24 that a possible Iran deal “isn't even fully negotiated yet,” while stating that any agreement would not give Iran “a clear and open path to a Nuclear Weapon.”[4] Trump later stated that negotiations are proceeding in an “orderly and constructive manner,” but added that he had instructed his representatives ”not to rush into a deal” because time is on the US side.[5] Trump also stated that the US naval blockade ”will remain in full force and effect” until an agreement is “reached, certified, and signed.”[6]

Iranian officials, Islamic Revolutionary Guards Corps (IRGC)-affiliated outlets, and Iranian sources speaking to Western and regional media are presenting the possible MOU as conditional on US concessions and continued Iranian leverage. An unspecified senior Iranian official told Reuters on May 24 that the Supreme National Security Council (SNSC) will convene to approve or reject the current draft and will send it to Mojtaba for final approval if the SNSC approves it.[7] An unspecified senior Iranian source separately told CNN that recent mediated talks have made “a lot of progress” and could mark a “turning point” toward ending the war and creating a “new era of stability and prosperity” in the region.[8] IRGC-affiliated Tasnim News Agency reported on May 24 that disputes over one or two provisions remain unresolved due to US “obstruction” and that the MOU could still fall through if the United States does not meet Iranian demands.[9] US “obstruction” in this context probably refers to US insistence on legitimate demands that the Iranians oppose. IRGC-affiliated reporting has identified frozen assets, sanctions relief, the naval blockade, Lebanon, and the Strait of Hormuz as the main unresolved issues.[10] This is every issue in the first stage of the agreement, before talks on the nuclear program. Tasnim reported that an informed source said Iran will not accept any understanding without the release of a “specified portion” of Iran's blocked assets in the first step and a clear mechanism to guarantee continued access to all blocked assets.[11] A well-informed Iranian source told an Al Jazeera journalist on May 24 that the two central issues involve the mechanism for unfreezing Iranian assets and the scope of a Lebanon ceasefire.[12] The source added that Iran rejected a Pakistani proposal to move ahead with agreed provisions while postponing unresolved ones.[13]

IRGC-affiliated messaging in domestic Iranian media has said that Iran will stick to its redlines, while quotes from unspecified Iranian officials in Western media have sought to portray the talks in a positive light by describing “progress.” Unspecified Iranian officials speaking to Western outlets have described progress and an internal approval process through the SNSC and Mojtaba, which suggests that some Iranian officials want to present the draft as a viable diplomatic path.[14] IRGC-affiliated outlets, however, have emphasized red lines, US “obstruction,” blocked assets, sanctions relief, and continued Iranian control over the Strait of Hormuz.[15]

Mediators appear to be trying to preserve momentum toward a US-Iran MOU by sequencing unresolved issues and developing technical arrangements for the Strait of Hormuz, but Iranian reporting suggests that Iran has rejected efforts to defer its core demands. Reuters reported on May 23 that the “Pakistani army” described the negotiations as producing “encouraging” progress toward a final understanding, while two Pakistani sources involved in the talks said the deal under discussion is “fairly comprehensive to terminate the war.”[16] The sources added that the proposed framework would unfold in three stages, including formally ending the war, resolving the crisis in the Strait of Hormuz, and launching a 30-day window for negotiations on a broader agreement that could be extended.[17]

Iran appears to believe that it is negotiating from a stronger position than the United States and is accordingly attempting to remake the regional order in a way that benefits Iran. Supreme Leader's military adviser and former IRGC Commander Major General Mohsen Rezaei claimed on May 24 that the United States is in a “complete stalemate” and warned that any renewed war would begin at the strait and expand through the Bab el Mandeb and the Indian Ocean.[18] Rezaei also claimed that Iran has kept the strait open to free trade while requiring vessels to be “identified and registered,” which supports Iran's efforts to normalize an Iranian permission-based transit regime.[19] IRGC Navy Public Relations reported on May 24 that 33 ships, including oil tankers, container ships, and other commercial vessels, passed through the Strait of Hormuz over the past 24 hours after obtaining permission and with IRGC Navy coordination and security.[20] Khatam ol Anbia Central Headquarters Commander Major General Ali Abdollahi Aliabadi separately said on May 24 that Mojtaba’s plans to manage the Persian Gulf and the Strait of Hormuz will shape a “new regional and global order” under the “Strong Iran” strategy, “in which foreigners will have no place.”[21] IRGC-affiliated Fars News separately framed the talks in an Op-Ed on May 24 as a vehicle to secure concrete economic gains rather than broader political conciliation with the United States.[22] IRGC-affiliated Tasnim also reported that Iran would return ship traffic through the strait to pre-war numbers within 30 days, while the United States would fully lift the naval blockade in the same period.[23]

Iran has not publicly accepted meaningful nuclear concessions in the possible MOU, and Iran believes that the draft defers nuclear talks until after Iran secures relief from military and economic pressure. Tasnim denied reports that Iran committed to remove nuclear material from the country or suspend nuclear activity for 10 to 20 years, claiming instead that Iran has made no nuclear-related commitments at this stage and will only discuss nuclear issues after the possible end of the war and after the United States “implements certain measures.”[24] A senior Iranian source separately told Reuters that the nuclear issue is not part of the memorandum and that Iran has not agreed to hand over its highly enriched uranium stockpile.[25] Mohsen Rezaei separately threatened that Iran may withdraw from the Nuclear Non-Proliferation Treaty in response to US military action against the Strait of Hormuz or the Persian Gulf, further linking Iran's nuclear posture to its effort to deter US military pressure around the strait.[26] Western and regional reporting has presented a different version of the nuclear issue, however. Two US officials told the New York Times on May 23 that one key element of the proposed agreement is a reported Iranian commitment to give up its highly enriched uranium stockpile.[27] It remains unclear how Iran would give up the stockpile and leaves those details for a future round of nuclear talks, according to US officials.[28]

Iranian officials have stated that the US-Iran MOU must end the war “on all fronts,” including in Lebanon.[29] The United States supports continued Israeli operations against Hezbollah, however, to prevent threats to Israel. Iranian officials speaking to the New York Times and IRGC-affiliated media separately claimed on May 24 that the US-Iran MOU text specifically states that there must be a complete end to the war “on all fronts,” including in Lebanon.[30] Iranian Foreign Minister Abbas Araghchi sent a letter to Hezbollah Secretary General Naim Qassem on May 23 confirming that Iran has linked negotiations to securing a complete ceasefire in Lebanon, according to Hezbollah-affiliated media.[31]

Israeli officials have reportedly called on the United States to allow the Israel Defense Forces (IDF) to continue its operations in Lebanon, in accordance with the current temporary ceasefire in Lebanon, and President Trump agreed with this position.[32] An Israeli official released a statement to Western media on May 24 saying that Israeli Prime Minister Netanyahu, during a phone call with US President Trump on May 23, emphasized that Israel will maintain its freedom of action in Lebanon.[33] President Trump agreed with Israel's position. An Iranian source told a Qatari media journalist on May 24 that Israel is reportedly calling for the United States to include language in the MOU that allows the IDF to continue to conduct military actions in Lebanon in response to “any threat,” similar to the current temporary ceasefire between Israel and Lebanon which contains a provision that permits the IDF to act in self-defense against any “planned, imminent, or ongoing” Hezbollah threats against Israel.[34] The Iranian source stated that Iran rejects including a similar provision in the MOU and insists upon a complete ceasefire in Lebanon.[35]

Hezbollah officials have continuously reiterated that the group will continue to engage the IDF in southern Lebanon and launch attacks against northern Israel until the IDF completely halts its activity in Lebanon and withdraws from southern Lebanese territory.[36] Qassem has repeatedly stated that Israel must completely halt its operations, withdraw from southern Lebanese territory, release prisoners, and allow southern Lebanese residents to return home for Hezbollah to agree to a total ceasefire.[37] Qassem also stated that Hezbollah currently seeks to inflict maximum IDF casualties to prevent the IDF from establishing operational control over the IDF buffer zone in southern Lebanon.[38] Israeli officials have continuously stated that the IDF will remain in a buffer zone in southern Lebanon to protect northern Israeli communities from ongoing and future Hezbollah attacks.[39] The IDF and Hezbollah have also increasingly clashed in direct engagements in southern Lebanon in recent weeks as the IDF has expanded its operational control over territory in southern Lebanon and prepared for further advances. The IDF announced on May 12 that it crossed the Litani River and developed a bridgehead to facilitate ground force movement north of the river, and Hezbollah mounted a prolonged, direct-fire defense against a separate advancing Israeli force in southern Lebanon on May 19 and May 20, for example.[40] The IDF has also built new roadways within its area of operational control along major Israeli axes of advance, likely to sustain ground operations and logistical bases.[41]

The IRGC Aerospace Force used a UAE-based company to acquire advanced Chinese satellite equipment in late 2025, according to leaked documents cited by the Financial Times on May 24.[42] The company facilitated the shipment of Chinese-made satellite antenna equipment to Iran via the Jebel Ali port in Dubai on behalf of an IRGC Aerospace Force front company in late 2025.[43] The US Treasury Department previously sanctioned several Chinese companies in May 2026 for providing satellite imagery to Iran to support Iranian attacks against US forces in the region during the war.[44]

https://understandingwar.org/research/middle-east/iran-update-special-report-may-24-2026/

2,079 posted on 05/24/2026 10:43:21 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 2059 | View Replies]

Ghalibaf becomes speaker of parliament for seventh year.

Ghalibaf was elected speaker of parliament with 235 votes out of 271. Mohammad Taghi Naqd Ali and Osman Salari received 29 and 7 votes, respectively, for the position of president; there were 5 blank ballots; and a total of 276 ballots were distributed.

source (IRGC linked) https://tasnimnews.ir/fa/news/1405/03/04/3599861/%D9%82%D8%A7%D9%84%DB%8C%D8%A8%D8%A7%D9%81-%D8%A8%D8%B1%D8%A7%DB%8C-%D9%87%D9%81%D8%AA%D9%85%DB%8C%D9%86-%D8%B3%D8%A7%D9%84-%D8%B1%D8%A6%DB%8C%D8%B3-%D9%85%D8%AC%D9%84%D8%B3-%D8%B4%D8%AF

Mohammad Taghi Naqd Ali is a Principlist. He gained international attention during the 2022–2023 protests for fiercely advocating for the execution of arrested demonstrators and pushing to restrict the free press. He has also championed aggressive punishments for defying the compulsory hijab

Osman Salari is a prominent voice regarding state security structures. He publicly emphasized that the Iranian Parliament holds no authority to dictate policy to the Supreme National Security Council, maintaining that the “first and last word on war and peace” rests strictly with Supreme Leader


2,080 posted on 05/25/2026 1:25:03 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 2079 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 2,041-2,0602,061-2,0802,081-2,100 ... 2,281-2,293 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
General/Chat
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson