Free Republic
Browse · Search
General/Chat
Topics · Post Article

Iran Update Special Report, May 24, 2026

Conflicting US, Iranian, and regional reporting indicates that the contours of a possible US-Iran memorandum of understanding (MOU) remain unresolved and may not yet represent a final agreement. US President Donald Trump stated on May 23 that a deal to end the war had been “largely negotiated” and awaited finalization.[1] A senior US official stated in a briefing with reporters on May 24 that the White House does not expect an agreement on May 24 and believes Iranian leadership, including Supreme Leader Mojtaba Khamenei, may need several days to approve the deal.[2] An unspecified senior US official told Axios that the United States is in a “very good place” but that the parties are still negotiating specific language and that “whether this becomes an agreement is still an open question.”[3] Trump separately stated on May 24 that a possible Iran deal “isn't even fully negotiated yet,” while stating that any agreement would not give Iran “a clear and open path to a Nuclear Weapon.”[4] Trump later stated that negotiations are proceeding in an “orderly and constructive manner,” but added that he had instructed his representatives ”not to rush into a deal” because time is on the US side.[5] Trump also stated that the US naval blockade ”will remain in full force and effect” until an agreement is “reached, certified, and signed.”[6]

Iranian officials, Islamic Revolutionary Guards Corps (IRGC)-affiliated outlets, and Iranian sources speaking to Western and regional media are presenting the possible MOU as conditional on US concessions and continued Iranian leverage. An unspecified senior Iranian official told Reuters on May 24 that the Supreme National Security Council (SNSC) will convene to approve or reject the current draft and will send it to Mojtaba for final approval if the SNSC approves it.[7] An unspecified senior Iranian source separately told CNN that recent mediated talks have made “a lot of progress” and could mark a “turning point” toward ending the war and creating a “new era of stability and prosperity” in the region.[8] IRGC-affiliated Tasnim News Agency reported on May 24 that disputes over one or two provisions remain unresolved due to US “obstruction” and that the MOU could still fall through if the United States does not meet Iranian demands.[9] US “obstruction” in this context probably refers to US insistence on legitimate demands that the Iranians oppose. IRGC-affiliated reporting has identified frozen assets, sanctions relief, the naval blockade, Lebanon, and the Strait of Hormuz as the main unresolved issues.[10] This is every issue in the first stage of the agreement, before talks on the nuclear program. Tasnim reported that an informed source said Iran will not accept any understanding without the release of a “specified portion” of Iran's blocked assets in the first step and a clear mechanism to guarantee continued access to all blocked assets.[11] A well-informed Iranian source told an Al Jazeera journalist on May 24 that the two central issues involve the mechanism for unfreezing Iranian assets and the scope of a Lebanon ceasefire.[12] The source added that Iran rejected a Pakistani proposal to move ahead with agreed provisions while postponing unresolved ones.[13]

IRGC-affiliated messaging in domestic Iranian media has said that Iran will stick to its redlines, while quotes from unspecified Iranian officials in Western media have sought to portray the talks in a positive light by describing “progress.” Unspecified Iranian officials speaking to Western outlets have described progress and an internal approval process through the SNSC and Mojtaba, which suggests that some Iranian officials want to present the draft as a viable diplomatic path.[14] IRGC-affiliated outlets, however, have emphasized red lines, US “obstruction,” blocked assets, sanctions relief, and continued Iranian control over the Strait of Hormuz.[15]

Mediators appear to be trying to preserve momentum toward a US-Iran MOU by sequencing unresolved issues and developing technical arrangements for the Strait of Hormuz, but Iranian reporting suggests that Iran has rejected efforts to defer its core demands. Reuters reported on May 23 that the “Pakistani army” described the negotiations as producing “encouraging” progress toward a final understanding, while two Pakistani sources involved in the talks said the deal under discussion is “fairly comprehensive to terminate the war.”[16] The sources added that the proposed framework would unfold in three stages, including formally ending the war, resolving the crisis in the Strait of Hormuz, and launching a 30-day window for negotiations on a broader agreement that could be extended.[17]

Iran appears to believe that it is negotiating from a stronger position than the United States and is accordingly attempting to remake the regional order in a way that benefits Iran. Supreme Leader's military adviser and former IRGC Commander Major General Mohsen Rezaei claimed on May 24 that the United States is in a “complete stalemate” and warned that any renewed war would begin at the strait and expand through the Bab el Mandeb and the Indian Ocean.[18] Rezaei also claimed that Iran has kept the strait open to free trade while requiring vessels to be “identified and registered,” which supports Iran's efforts to normalize an Iranian permission-based transit regime.[19] IRGC Navy Public Relations reported on May 24 that 33 ships, including oil tankers, container ships, and other commercial vessels, passed through the Strait of Hormuz over the past 24 hours after obtaining permission and with IRGC Navy coordination and security.[20] Khatam ol Anbia Central Headquarters Commander Major General Ali Abdollahi Aliabadi separately said on May 24 that Mojtaba’s plans to manage the Persian Gulf and the Strait of Hormuz will shape a “new regional and global order” under the “Strong Iran” strategy, “in which foreigners will have no place.”[21] IRGC-affiliated Fars News separately framed the talks in an Op-Ed on May 24 as a vehicle to secure concrete economic gains rather than broader political conciliation with the United States.[22] IRGC-affiliated Tasnim also reported that Iran would return ship traffic through the strait to pre-war numbers within 30 days, while the United States would fully lift the naval blockade in the same period.[23]

Iran has not publicly accepted meaningful nuclear concessions in the possible MOU, and Iran believes that the draft defers nuclear talks until after Iran secures relief from military and economic pressure. Tasnim denied reports that Iran committed to remove nuclear material from the country or suspend nuclear activity for 10 to 20 years, claiming instead that Iran has made no nuclear-related commitments at this stage and will only discuss nuclear issues after the possible end of the war and after the United States “implements certain measures.”[24] A senior Iranian source separately told Reuters that the nuclear issue is not part of the memorandum and that Iran has not agreed to hand over its highly enriched uranium stockpile.[25] Mohsen Rezaei separately threatened that Iran may withdraw from the Nuclear Non-Proliferation Treaty in response to US military action against the Strait of Hormuz or the Persian Gulf, further linking Iran's nuclear posture to its effort to deter US military pressure around the strait.[26] Western and regional reporting has presented a different version of the nuclear issue, however. Two US officials told the New York Times on May 23 that one key element of the proposed agreement is a reported Iranian commitment to give up its highly enriched uranium stockpile.[27] It remains unclear how Iran would give up the stockpile and leaves those details for a future round of nuclear talks, according to US officials.[28]

Iranian officials have stated that the US-Iran MOU must end the war “on all fronts,” including in Lebanon.[29] The United States supports continued Israeli operations against Hezbollah, however, to prevent threats to Israel. Iranian officials speaking to the New York Times and IRGC-affiliated media separately claimed on May 24 that the US-Iran MOU text specifically states that there must be a complete end to the war “on all fronts,” including in Lebanon.[30] Iranian Foreign Minister Abbas Araghchi sent a letter to Hezbollah Secretary General Naim Qassem on May 23 confirming that Iran has linked negotiations to securing a complete ceasefire in Lebanon, according to Hezbollah-affiliated media.[31]

Israeli officials have reportedly called on the United States to allow the Israel Defense Forces (IDF) to continue its operations in Lebanon, in accordance with the current temporary ceasefire in Lebanon, and President Trump agreed with this position.[32] An Israeli official released a statement to Western media on May 24 saying that Israeli Prime Minister Netanyahu, during a phone call with US President Trump on May 23, emphasized that Israel will maintain its freedom of action in Lebanon.[33] President Trump agreed with Israel's position. An Iranian source told a Qatari media journalist on May 24 that Israel is reportedly calling for the United States to include language in the MOU that allows the IDF to continue to conduct military actions in Lebanon in response to “any threat,” similar to the current temporary ceasefire between Israel and Lebanon which contains a provision that permits the IDF to act in self-defense against any “planned, imminent, or ongoing” Hezbollah threats against Israel.[34] The Iranian source stated that Iran rejects including a similar provision in the MOU and insists upon a complete ceasefire in Lebanon.[35]

Hezbollah officials have continuously reiterated that the group will continue to engage the IDF in southern Lebanon and launch attacks against northern Israel until the IDF completely halts its activity in Lebanon and withdraws from southern Lebanese territory.[36] Qassem has repeatedly stated that Israel must completely halt its operations, withdraw from southern Lebanese territory, release prisoners, and allow southern Lebanese residents to return home for Hezbollah to agree to a total ceasefire.[37] Qassem also stated that Hezbollah currently seeks to inflict maximum IDF casualties to prevent the IDF from establishing operational control over the IDF buffer zone in southern Lebanon.[38] Israeli officials have continuously stated that the IDF will remain in a buffer zone in southern Lebanon to protect northern Israeli communities from ongoing and future Hezbollah attacks.[39] The IDF and Hezbollah have also increasingly clashed in direct engagements in southern Lebanon in recent weeks as the IDF has expanded its operational control over territory in southern Lebanon and prepared for further advances. The IDF announced on May 12 that it crossed the Litani River and developed a bridgehead to facilitate ground force movement north of the river, and Hezbollah mounted a prolonged, direct-fire defense against a separate advancing Israeli force in southern Lebanon on May 19 and May 20, for example.[40] The IDF has also built new roadways within its area of operational control along major Israeli axes of advance, likely to sustain ground operations and logistical bases.[41]

The IRGC Aerospace Force used a UAE-based company to acquire advanced Chinese satellite equipment in late 2025, according to leaked documents cited by the Financial Times on May 24.[42] The company facilitated the shipment of Chinese-made satellite antenna equipment to Iran via the Jebel Ali port in Dubai on behalf of an IRGC Aerospace Force front company in late 2025.[43] The US Treasury Department previously sanctioned several Chinese companies in May 2026 for providing satellite imagery to Iran to support Iranian attacks against US forces in the region during the war.[44]

https://understandingwar.org/research/middle-east/iran-update-special-report-may-24-2026/

2,079 posted on 05/24/2026 10:43:21 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 2059 | View Replies ]


Ghalibaf becomes speaker of parliament for seventh year.

Ghalibaf was elected speaker of parliament with 235 votes out of 271. Mohammad Taghi Naqd Ali and Osman Salari received 29 and 7 votes, respectively, for the position of president; there were 5 blank ballots; and a total of 276 ballots were distributed.

source (IRGC linked) https://tasnimnews.ir/fa/news/1405/03/04/3599861/%D9%82%D8%A7%D9%84%DB%8C%D8%A8%D8%A7%D9%81-%D8%A8%D8%B1%D8%A7%DB%8C-%D9%87%D9%81%D8%AA%D9%85%DB%8C%D9%86-%D8%B3%D8%A7%D9%84-%D8%B1%D8%A6%DB%8C%D8%B3-%D9%85%D8%AC%D9%84%D8%B3-%D8%B4%D8%AF

Mohammad Taghi Naqd Ali is a Principlist. He gained international attention during the 2022–2023 protests for fiercely advocating for the execution of arrested demonstrators and pushing to restrict the free press. He has also championed aggressive punishments for defying the compulsory hijab

Osman Salari is a prominent voice regarding state security structures. He publicly emphasized that the Iranian Parliament holds no authority to dictate policy to the Supreme National Security Council, maintaining that the “first and last word on war and peace” rests strictly with Supreme Leader


2,080 posted on 05/25/2026 1:25:03 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 2079 | View Replies ]

Iran Update Special Report, May 25, 2026

The United States and Iran continue to hold fundamentally different positions on most major issues within the US-Iran “agreement.” Iran has not publicly committed to removing its highly enriched uranium (HEU) stockpiles or to halting uranium enrichment in Iran, reinforcing broader uncertainty around the negotiations. Iran has so far been unwilling to transfer its HEU stockpile outside Iran, and officials and media consistently assert that any US demand for zero enrichment—or even a return to Joint Comprehensive Plan of Action (JCPOA) — level enrichment at 3.6% — is a red line for Iran.[1] US President Donald Trump said on May 25 that any deal with Iran must be “great and meaningful,“ and explicitly rejected “anything like the JCPOA.”[2]

These two positions on the nuclear issue are fundamentally at odds, even as talks continue and the United States has offered various concessions to attempt to get Iran to give up on aspects of its nuclear program. Unspecified mediators also told the Wall Street Journal on May 25 that the United States is seeking firm upfront nuclear commitments and fears that Iran may delay on these commitments.[3] US officials have reportedly offered sanctions relief in return for Iran handing over its HEU stockpile, according to a senior US official, but unspecified mediators told the Wall Street Journal that Iran still seeks ”clearer guarantees” on sanctions relief and access to frozen assets.[4] An Iranian delegation, led by Parliament Speaker Mohammad Bagher Ghalibaf, met senior Qatari officials in Doha on May 25, reportedly to discuss negotiations, including Iran's HEU stockpile and access to frozen assets, though no concrete outcomes have been publicly confirmed.[5] Iranian Foreign Affairs Minister Abbas Araghchi and Central Bank Governor Abdol Nasser Hemmati attended the meeting too.[6]

Saudi state media has continued to portray the talks in a positive light, even while public positions have so far failed to change. Saudi media stated on May 25 that a draft US–Iran memorandum of understanding (MOU) outlines a phased deal involving a renewable 60‑day ceasefire, continued nuclear talks, regional de‑escalation, restoration of navigation in the Strait of Hormuz, gradual sanctions relief, and partial release of frozen Iranian assets.[7] Saudi media did not elaborate as to whether or not either side had agreed to any of the provisions in the draft. Saudi media also reported that Iran is willing to transfer its HEU stockpile to the People's Republic of China (PRC) but is seeking guarantees from the PRC before continuing with the agreement with the United States.[8] These outlets have previously been premature when discussing Iran's threshold for agreement when it comes to its nuclear program, however. Islamic Revolutionary Guards Corps (IRGC)-affiliated media swiftly denied the Saudi media report on the MOU terms.[9]

Iran has continued to claim that it and Oman control the Strait of Hormuz as territorial waters. Iranian officials are attempting to reframe transit tolls as “protection fees” to give Iran's protection racket the veneer of legality. The Strait of Hormuz is an international waterway under international law. Iran is claiming that the strait is territorial waters and under the administration of “coastal” states. It is notable in this context that Iran does not define the United Arab Emirates (UAE) as a coastal state, even though the UAE borders the strait.[10] The Iranian Ministry of Foreign Affairs spokesperson has attempted to reframe transit tolls as ”protection fees” and “environmental fees,” but both of these are tolls, and neither is legal in an international waterway.[11] Iran remains the only power that has threatened civilian shipping in the Strait of Hormuz during this war, meaning that its “protection fee” is a protection racket that ships must pay to avoid Iranian attack. US officials are explicitly against any fee system in the Strait of Hormuz, and this issue remains a core disagreement in ongoing talks.[12]

US President Donald Trump urged on May 25 the leaders of Saudi Arabia, Qatar, Pakistan, Egypt, Turkey, and Jordan to join the Abraham Accords.[13] Trump said that Saudi Arabia and Qatar should be the first countries to do so and added that a failure to join the Abraham Accords “shows bad intention.”[14] Turkey, Egypt, and Jordan currently recognize Israel but are not members of the Accords.[15]

Hezbollah drone operators have likely developed a rudimentary tactical approach to coordinate multiple small first-person view (FPV) drone strikes in a short period of time. Hezbollah has posted at least three separate examples of these operations, which they call “swarm” attacks. Normal Hezbollah FPV drone attacks have a simple three-step process: first, a drone conducts reconnaissance. Next, commanders evaluate the drone footage in real-time to determine and select possible targets. Finally, a second drone executes the strike. The “swarm” attacks appear to employ three or more drones operating in a staggered but near-simultaneous manner.[16] The first drone selects and strikes its target.[17] The second drone then takes footage of the first drone's target, likely to conduct a hasty battle damage assessment (BDA) to determine whether a re-strike is necessary.[18] A Hezbollah drone in a “swarm” attack in Biyyadah on May 15 re-struck a Humvee, for example, after an earlier drone struck the same target.[19] This footage also serves a propaganda role, and Hezbollah is releasing this footage publicly.[20] The second drone then conducts its own strike.[21] The Hezbollah drone operators repeat this process for each drone thereafter.[22] This system is extremely rudimentary and would either require a single commander to coordinate the attack or a preset, prioritized list of strikes that cannot be dynamically changed.

Hezbollah will likely attempt to overcome the shortcomings of this tactical approach. The requirement for a single commander and subsequent drones to execute the BDA slows Hezbollah's targeting cycle and will prevent it from executing simultaneous attacks with drones. Hezbollah, as a learning military organization, will not be satisfied with these constraints and will seek to improve its approach, especially as the IDF develops new countermeasures.[23]

Hezbollah has illustrated this tactical approach in its publicly released video footage on at least three occasions. Hezbollah posted footage of several drones striking an IDF border post in northern Israel on May 12, which Israeli media and Hezbollah subsequently called a “swarm attack.”[24] Israeli media expressed concern over the increasingly complex Hezbollah capabilities in this instance.[25] Hezbollah also posted footage on May 24 showing an attack using several FPV drones to target Israel Defense Forces (IDF) vehicles and positions in Rachaf, Bint Jbeil District, on May 21.[26] Rachaf is adjacent to Haddatha, where Hezbollah recently fought a protracted engagement with IDF forces on May 20 and 21.[27]

Iranian President Masoud Pezeshkian ordered the Communications Ministry on May 25 to end the internet shutdown that Iran began in response to the January 2026 protest movement.[28] Internet access is expected to return to the pre-January “status quo.”[29] ISW-CTP has continuously assessed that Iran's prolonged internet shutdown posed severe economic damage and accelerated unemployment, which likely increased pressure on regime stability.[30] The Iranian Supreme National Security Council (SNSC) has not yet approved Pezeshkian’s order. An IRGC-affiliated media outlet questioned Pezeshkian’s ability to rescind the shutdown order, given that the SNSC originally issued the order.[31]

The Shia Coordination Framework is reportedly divided over a US proposal to disarm Iranian-backed Iraqi militias and dissolve or integrate the Popular Mobilization Forces (PMF). The PMF is an Iraqi state security service that includes many Iranian-backed Iraqi militias that answer to Iran instead of the Iraqi prime minister.[32] A framework source told Iraqi media on May 25 that some framework members with armed wings threatened to leave the framework if it supports a US proposal to dissolve the PMF, while others expressed a willingness to disarm and engage with Iraqi politics in exchange for securing “senior positions” within the Iraqi government.[33] Multiple Iranian-backed Iraqi militias, including Kataib Hezbollah, the Badr Organization, and Asaib Ahl al Haq, have political wings that are part of the framework and control some PMF brigades.[34] The details of this US proposal are unclear at the time of this writing. This report comes as an Iraqi committee comprised of Iranian-backed Badr Organization head Hadi al Ameri, Prime Minister-designate Ali al Zaydi, and caretaker Prime Minister Mohammad Shia al Sudani is reportedly close to finalizing an “executive plan” to disarm the Iraqi militias.[35] The plan includes the confiscation of militias’ medium and heavy weapons and the restructuring of the PMF, according to a senior Iraqi political official speaking to regional media on May 9.[36] The United States has pressured the Iraqi federal government to curb Iranian influence in Iraq, including via militia disarmament, since early 2025, but has intensified its efforts in recent months due to militia attacks against US and foreign targets in Iraq and the region during the war.[37]

https://understandingwar.org/research/middle-east/iran-update-special-report-may-25-2026/

2,088 posted on 05/25/2026 10:50:17 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 2079 | View Replies ]

Free Republic
Browse · Search
General/Chat
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson