To: Red Badger
2 posted on
12/18/2017 11:11:53 AM PST by
dfwgator
To: Red Badger
3 posted on
12/18/2017 11:14:12 AM PST by
BenLurkin
(The above is not a statement of fact. It is either satire or opinion. Or both.)
To: Red Badger
How many passing years are required for grave desecration to become archaeology? I’d like to do some archaeological research on Ted Kennedy’s (D-HELL) victim Mary Jo’s grave, to check the state of her pregnancy and get a DNA sample of the baby to compare with his.
4 posted on
12/18/2017 11:16:25 AM PST by
JimRed
( TERM LIMITS, NOW! Build the Wall Faster! TRUTH is the new HATE SPEECH.)
To: Red Badger
I’m getting tired of being “ProtectOurFreedom.” Can I change to Helmins Strongyle, Ascaris, or Helmins Plateia?
To: Red Badger
Why is that a surprise? Go to 3rd world hell homes in Africa, Asia, South and Central America and you’ll find plenty of people with worms. You can get intestinal worms from walking barefoot on filthy ground.
9 posted on
12/18/2017 11:20:31 AM PST by
Vaquero
(Don't pick a fight with an old guy. If he is too old to fight, he'll just kill you.)
To: Red Badger
13 posted on
12/18/2017 11:26:41 AM PST by
Army Air Corps
(Four Fried Chickens and a Coke)
To: Red Badger
Amazing. Modern poo (liberals) is also strongly associated with parasites. That Hippocrates was a brilliant man. He got it right for his times and anticipated ours.
To: Red Badger
Why would this be news? Kind of like crowing that they discovered animals back then got fleas.....
17 posted on
12/18/2017 11:39:12 AM PST by
trebb
(Where in the the hell has my country gone?)
To: Red Badger
Symptoms included in the Hippocratic Corpus included weakness, vomiting (and vomiting worms),
Vomiting worms, I hate when that happens.
It would be enough to make me Scromit.
19 posted on
12/18/2017 11:43:42 AM PST by
tet68
( " We would not die in that man's company, that fears his fellowship to die with us...." Henry V.)
To: Red Badger
was often flat-out incorrect ("wandering uterus", anyone?). Oh, this totally exists.
My ex wife had a bad case.
21 posted on
12/18/2017 11:49:38 AM PST by
SIDENET
(My next tagline will be so awesome.)
To: Red Badger
26 posted on
12/18/2017 12:01:07 PM PST by
Vaquero
(Don't pick a fight with an old guy. If he is too old to fight, he'll just kill you.)
To: Red Badger; SaveFerris; PROCON; FredZarguna; mylife; Lil Flower; Corky Ramirez; CopperTop; ...
Hey, Ben. I need a four letter word. Winnie the blank.
30 posted on
12/18/2017 12:48:54 PM PST by
Gamecock
(The greatest threat to humanity is not "out there" but "in here" in the recesses of the soul. TK)
To: Red Badger
38 posted on
12/21/2017 11:46:58 AM PST by
AdmSmith
(GCTGATATGTCTATGATTACTCAT)
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson
