Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: agitprop; bidenswar; bobomaximus; dailydeathfap; dailypropaganda; dualcitizenssuck; escalation; fishiemaximus; ghoulishdelight; gleefulnosegold; globohomo; hopium; nato; oyveygoyim; phdft; propagandareturns; put; putin; russia; siloviki; snufffilmsonfr; snufffilmtx; snuffyfromtexas; spammyintexas; speedomaximus; stankazztexicunt; talkingtomypif; ukraine; unhealthyobsession; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath
Navigation: use the links below to view more comments.
first previous 1-20 ... 3,681-3,7003,701-3,7203,721-3,740 ... 4,861-4,874 next last
To: blitz128; Chad C. Mulligan; AdmSmith; SpeedyInTexas; PIF; USA-FRANCE; Monterrosa-24; MeganC; ...

I particularly like your next to last paragraph referring to Putin’s “Peace Plan”. One provision is he wants ALL of each Oblast (county) where he has occupied PART of the Oblast. In other words the people who worked so hard to rescue Kherson and the territory west of the river would have to give it all back. Ain’t gonna happen! His peace proposal would increase the 20% of Ukraine he now occupies to around 30%. How soon before he would move on the rest of Ukraine?

Good news from NATO, now meeting in DC. If I understand correctly, they have now agreed to allow Ukraine to use long range gift missiles and bombs in Crimea. If Putin thought a massive bombing raid on Ukraine, including hitting a children’s cancer hospital would intimidate NATO, he obviously does not understand the Western mind or its true Christian ethics.


3,701 posted on 07/10/2024 5:47:58 PM PDT by gleeaikin ( Question authority an you provide links)
[ Post Reply | Private Reply | To 3671 | View Replies]

To: BeauBo

I saw a report that Modi was definately upset about the hospital strike and apparently made reference to his upset publicly. Perhaps he will change his mind on a few things.


3,702 posted on 07/10/2024 5:58:20 PM PDT by gleeaikin ( Question authority an you provide links)
[ Post Reply | Private Reply | To 3688 | View Replies]

To: SpeedyInTexas
BBC: Nato vows 'irreversible path' to Ukraine membership

(They went with the word "irreversible")

NATO Expansion is Non-negotiable!


3,703 posted on 07/10/2024 6:04:35 PM PDT by BeauBo
[ Post Reply | Private Reply | To 3697 | View Replies]

To: gleeaikin

“Modi was definately upset about the (Children’s) hospital strike”

Bill Browder, an early investor in post-Soviet Russia, who championed the Magnitsky Act (which authorizes the U.S. government to sanction those foreign government officials worldwide that are human rights offenders, freeze their assets, and ban them from entering the U.S.), said that he used to worry that people would eventually tire of hearing from him about Putin’s malfeasance - that it was only natural to expect fatigue to set in.

But every time people’s interest might flag, Putin committed some new atrocity, that reignited it. Browder says that he has learned that Putin is his own worst enemy in that regard. Reliably offensive to any moral person who watches.


3,704 posted on 07/10/2024 6:17:21 PM PDT by BeauBo
[ Post Reply | Private Reply | To 3702 | View Replies]

To: SpeedyInTexas; ansel12

Business Insider: A new US-Swedish bomb (GLSDB) may have already been pulled from Ukraine because it’s useless against Russian jamming

“Ukrainian and Western officials told The Wall Street Journal that the Ground-Launched Small Diameter Bomb (GLSDB), manufactured by Boeing and Swedish company Saab, had failed and was no longer in use pending an overhaul...

...As previously reported by Business Insider’s Mia Jankowicz, Ukraine received the bombs in early February after months of requesting long-range munitions in the hope of hitting targets in areas like Crimea.

In April, Defense One reported that Bill LaPlante, the Pentagon’s acquisition chief, had said a ground-launched version of an air-to-ground weapon had become vulnerable to Russian electronic warfare. The publication said he was likely referring to the GLSDB...

...A month later, three sources familiar with the matter told Reuters that the bombs’ guidance systems were running into Russian jamming, causing many of the launches to miss their targets...

...The weapons are GPS-guided, meaning that Russia has been able to remotely scramble their signals using its sophisticated electronic warfare capability, according to The Journal.

It’s one of a number of precision-guided US weapons that Russia has been able to neutralize or reduce the effectiveness of using electronic warfare in Ukraine.

Russian electronic warfare units have blunted the effectiveness of HIMARS-fired Guided Multiple Launch Rocket Systems and air-launched Joint Direct Attack Munitions.”


3,705 posted on 07/10/2024 6:28:10 PM PDT by BeauBo
[ Post Reply | Private Reply | To 3698 | View Replies]

To: gleeaikin

That is good, however long range atacms needs to be unleashed on all of Russia, but most esp those air bases and Sam’s in range
And this time announcement has to come after atacms rain down hell on his aircraft , crews, maintainers, and airfield infrastructures

Pitins “peace plan” is the surrender of Ukraine, the balls to require a possibility of a cease fire after Ukrainians have left the areas he claims but has not even conquered is delusional

And that to a tee describes this ego maniacal evil person, delusional


3,706 posted on 07/10/2024 6:38:25 PM PDT by blitz128
[ Post Reply | Private Reply | To 3701 | View Replies]

To: blitz128

Going back to the many posts I’ve made regarding what I call his “guidestars”, you can easy see why he’s delusional. Ilyin, Gumilev, Dugin, they’re all looney tunes by western standards. Like the 20th century German fascists who went before them, they base their theories on fantasy and occult religion.


3,707 posted on 07/10/2024 11:19:06 PM PDT by Chad C. Mulligan
[ Post Reply | Private Reply | To 3706 | View Replies]

To: SpeedyInTexas

Select US military bases in Europe have instituted increased alert levels in response to intensified Russian sabotage and hybrid operations against NATO allies over the past several months. CNN reported on July 9, citing multiple sources familiar with the matter, that the US recently implemented additional safety protocols and raised the state of alert at US military bases in Europe after receiving intelligence that Russian-backed actors may be planning sabotage attacks against US facilities and personnel.[39] CNN’s sources stated that several US military bases in Europe raised their alert level to “Force Protection Condition Charlie,” which applies “when an incident occurs, or intelligence is received indicating some form of terrorist action or targeting against personnel or facilities is likely.”[40]

NATO Secretary General Jens Stoltenberg confirmed on July 10 that the US has increased its alert levels for some US bases in Europe and noted that Russian sabotage attempts and other malign acts against NATO allies are part of a campaign to intimidate NATO countries that support Ukraine.[41] Stoltenberg stated that NATO is increasing its awareness, intelligence sharing, and cyber defenses to combat increased Russian hybrid threats. The Washington Post reported on July 10, citing Kremlin documents obtained by an unspecified European intelligence service, that Russia is identifying individuals and recruiting sympathizers through social media to stage sabotage operations in Europe.[42] The Kremlin documents show that Kremlin political strategists in July 2023 analyzed the Facebook profiles of over 1,200 people who they believed were workers of the two large German plants and highlighted posts demonstrating an anti-government, anti-immigration, and anti-Ukraine position. Unspecified Western officials noted that Russia is increasingly working through proxies, including via internet recruits, which offers some deniability while maximizing the pool of potential recruits. Lithuanian Foreign Minister Gabrielius Landsbergis noted that individuals recruited online for Russian sabotage operations may not have a Russian handler in a NATO country.[43]

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-july-10-2024


3,708 posted on 07/11/2024 12:13:41 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 3653 | View Replies]

To: Chad C. Mulligan

Watching and listening to not only Putin but others as well from Russia you can see a very distorted view of what they see as their history and their “divine “ status.
I have questioned many on what being a “nazi” these days means, and have argued that the term or label means nothing, but actions do.

What did the nazis of ww2 era do? Putin and Russia in general have far more similarities to hitler and Nazi Germans than zelenski and Ukraine, and you have pointed out one more.

When I watched Putin give his “history lesson” to tucker I almost laughed.

I wondered as he rambled on, Humm I wonder what China thinks of his interpretation, and especially now as Russia is subservient to China if China will take historical context to “make things right”

Good for the goose…..


3,709 posted on 07/11/2024 2:52:07 AM PDT by blitz128
[ Post Reply | Private Reply | To 3707 | View Replies]

To: SpeedyInTexas

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view. ]

The complete transcript.

[ Russian Soldiers Turn Against heir Commanders ]


Today [ July 10 ], the most interesting news come from the Kharkiv direction.

Here, both Russian and Ukrainian forces continue to engage in intense combat for control of northern Vovchansk, with recent updates shedding light on the dire situation facing Russian troops.

Recent reports and footage have revealed that the Russian military is redeploying wounded soldiers to frontline combat in the Kharkiv direction. Social media images show soldiers from the 26th Tank Regiment, located northwest of Vovchansk, visibly injured, in casts, and on crutches, being sent to the front lines despite still undergoing medical treatment.

This information originated from a Russian military analyst, who noted that this practice has been ongoing for a considerable time. This desperate measure underscores the severe shortage of Russian troops, leading to refusals and near-revolts within the ranks.

Several days ago, Ukrainian Khortytsia Group Spokesperson Nazar Voloshyn reported that some Russian soldiers in the Vovchansk direction, particularly those from the 153rd Tank Regiment, are refusing to fight.

This highlights the severe morale issues and high casualty rates plaguing the Russian military. Ukrainian President Volodymyr Zelensky recently noted that Russian losses on some frontlines, especially in the Kharkiv direction, are as high as 6:1 compared to Ukrainian losses.

The high cost of Russian attempts to advance in northern Vovchansk is evident. Despite their efforts, Russian forces have struggled to make significant progress due to a shortage of adequately trained personnel and the heavy casualties they have sustained.

Ukrainian forces maintain control over most buildings within the Citadel, actively working to thwart Russian advances and disrupt the connection between Russian forces to the west and those entrenched at the aggregate plant.

Recent geolocated images have shown Ukrainian efforts to advance westward, in an area halfway between the Citadel and the aggregate plant. One video depicts an FPV drone attack on a now-destroyed medical center west of the aggregate plant, where several Russian soldiers were sheltering.

The drone footage provides an updated perspective of the entire area, highlighting the Citadel, the aggregate plant, and the areas near Soborna Street, which serves as a frontline for much of its length. After locating the Russian soldiers, Ukrainian drone operators executed an attack on the medical center, revealing that very few intact roofed areas remain.

Recent Ukrainian reports indicate ongoing efforts to encircle Russian troops at the Vovchansk Aggregate Plant. A Ukrainian soldier mentioned that the approaches to the plant are now under the fire control of the Armed Forces of Ukraine, making it extremely risky for Russian forces to receive reinforcements or ammunition supplies.

Conversely, Russian forces have reclaimed areas previously advanced by Ukrainians on Korolenka and Soborna Streets. Currently, they are attempting to seize the first buildings west of the Citadel. A recent geolocated video shows a Russian drone delivering medical supplies to soldiers of the 2nd Spetsnaz Battalion in one of the buildings within the Citadel.

Although Russian military analysts claim this area is under Russian control, the need to use a drone for medical supply deliveries suggests that these troops might be surrounded or have severely compromised logistic access.

Facing an extreme shortage of troops and high casualty rates, the Russians have begun constructing defensive lines as a precaution. This defensive posture indicates their acknowledgment of the significant challenges in sustaining an offensive in Vovchansk and maintaining control over their positions.

A prominent Russian military blogger recently criticized the Russian military command for their lack of progress in the Vovchansk direction. He highlighted that Russian forces are far from achieving their objective of creating a 15-kilometer buffer zone and are struggling with coordination in the Vovchansk area.

The blogger noted that Russian forces attacking within Vovchansk have already suffered a third of the casualties incurred during their 4 month campaign to seize Avdiivka. He attributed the lack of progress in Russian offensive operations in Vovchansk directly to Russian Colonel General Alexander Lapin.

Overall, both sides continue to engage in intense combat for control of northern Vovchansk, each striving to push the other from their strongholds. Gaining control of both the Citadel and the aggregate plant would provide a significant advantage in dominating the northern part of Vovchansk.

However, Russian forces are clearly struggling to maintain their personnel supply due to disproportionate casualty rates. Meanwhile, Ukrainian forces may have a tactical advantage in reserve. Analyst reports suggest that Ukrainians might be preparing for an imminent enveloping attack from the east, particularly from the Tikhe area, where recent updates indicate a significant buildup of Ukrainian forces for this objective.


3,710 posted on 07/11/2024 3:53:34 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 3698 | View Replies]

To: PIF

If these reports are true of men with casts and other injuries being sent back to the front, I wonder how long the Russians can keep this up and the soldiers continuing to obey in numbers

Revolt within the Russian military is not unknown in the past, putin the master historian must know this


3,711 posted on 07/11/2024 4:37:20 AM PDT by blitz128
[ Post Reply | Private Reply | To 3710 | View Replies]

To: gleeaikin; Chad C. Mulligan; PIF; USA-FRANCE; Monterrosa-24
gleeaikin: "His peace proposal would increase the 20% of Ukraine he now occupies to around 30%."

pink = Russian occupied areas of Ukraine.
blue = regions liberated from Russian occupation.

I've heard others say 20% too, so that's a number being thrown around.
The real number is around 14%, though you can make it look like 20% with some creative math.

  1. Ukraine is nearly the size of Texas, ~233,000 square miles.

  2. In March 2022 at the peak of Russian conquests, Russia occupied ~62,000 square miles of Ukraine = 27%

  3. By the end of 2022, Ukraine had liberated 29,000 square miles = 13%.

  4. This left Russians occupying 33,000 square miles = 14% of Ukraine.

  5. Since the end of 2022, Russians have conquered another roughly 300 square miles of Ukraine, at a cost of circa 400,000 casualties, or more than 1,000 casualties per square mile.
    The average ratio of Russian to Ukrainian casualties increased this year from 3 to 1, to now 6 to 1, with Russian Meat Wave assaults costing them up to 10 to 1 casualties.

  6. At the current rate, it will take Russia more than 1,000 years to conquer all of Ukraine, and will consume all of Russia's current 140 million population as casualties.
So where does that 20% number come from?
Well, if you subtract Russian occupied 33,000 square miles from Ukraine's 233,000 total = 200,000 then 33,000 divided by 200,000 = 17% which can be rounded up to 20%?


3,712 posted on 07/11/2024 5:02:44 AM PDT by BroJoeK (future DDG 134 -- we remember)
[ Post Reply | Private Reply | To 3701 | View Replies]

To: SpeedyInTexas




3,713 posted on 07/11/2024 5:13:02 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 3698 | View Replies]

To: SpeedyInTexas

Kremlin snuff box. 07/11/24
https://t.me/s/kremlin_secrets

Our hopes for NATO were not realized. In how many years will the SVO end now?

NATO, having declared at its summit “the future of Ukraine in the alliance,” did not live up to Russia’s hopes and rejected one of our country’s demands to resolve the Ukrainian crisis. The North Military District will now most likely end in our victory no earlier than in 3-5 years.

This opinion was expressed by sources among the military. “We - I’ll be completely honest, why hide it if everyone knows about it - hoped to intimidate the Americans and their allies. This was partially successful; Ukraine is not being accepted into NATO right now.

“But overall, hopes were not justified. We will, of course, win, but with the current level of NATO support for the Kyiv regime, victory is, unfortunately, impossible for now. It takes several years, from 3 to 5 for sure,” a general from the Ministry of Defense told us.

He believes that “society must recognize this threat. And prepare to take a greater part in the war.” And this, according to the interlocutor, is now a big problem.

Another source hopes that NATO will not take more drastic steps. “Now it will be difficult to fight the Americans ; we must first defeat the Ukrainians. But this is still difficult to do; it takes time,” he explained.

By the way, not all interlocutors adhere to this position. “We are capable of fighting NATO. Yes, there will be inconveniences like large-scale mobilization or overnight stays in bomb shelters, but everything has its price. We are strong and, I think, are ready for such difficulties,” says a source in the Ministry of Defense close to Andrei Belousov.

At the same time, the SVO, in his opinion, “may well last another 6-7 years . The main thing is the result.”


3,714 posted on 07/11/2024 5:16:06 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 3698 | View Replies]

To: BroJoeK

“...Ukraine is nearly the size of Texas...”

Put another way, Ukraine is larger than the combined US states of Indiana, Kentucky, Tennessee, Alabama, and Mississippi and those reach from the Great Lakes to the Gulf of Mexico.

Ukraine is over 30 times larger than Chechnya which Russia had trouble temporarily subduing. The Putinistas like to say that Russia has been very restrained on blasting Ukrainian cities and could have leveled the whole place like they did Chechnya. But Russia did not have the resources to just level all of Ukraine as they did Mariupol and many mill towns in the Donbas. The decisive factor was that Ukraine showed fight and Russia faced a real war instead of a “special military operation.”


3,715 posted on 07/11/2024 7:05:10 AM PDT by Monterrosa-24 (Saludemos la patria orgullosos)
[ Post Reply | Private Reply | To 3712 | View Replies]

To: PIF; All

10 more. The same as it ever was.

Tanks (3219, of which destroyed: 2185, damaged: 157, abandoned: 359, captured: 518)


3,716 posted on 07/11/2024 7:16:08 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 3715 | View Replies]

To: PIF

And you may find yourself living in a shotgun shack
And you may find yourself in another part of the world
And you may find yourself behind the wheel of a large automobile
And you may find yourself in a beautiful house, with a beautiful wife
And you may ask yourself, “Well, how did I get here?”

Letting the days go by, let the water hold me down
Letting the days go by, water flowing underground
Into the blue again, after the money’s gone
Once in a lifetime, water flowing underground

And you may ask yourself, “How do I work this?”
And you may ask yourself, “Where is that large automobile?”
And you may tell yourself, “This is not my beautiful house”
And you may tell yourself, “This is not my beautiful wife”

Letting the days go by, let the water hold me down
Letting the days go by, water flowing underground
Into the blue again, after the money’s gone
Once in a lifetime, water flowing underground

Same as it ever was, same as it ever was
Same as it ever was, same as it ever was
Same as it ever was, same as it ever was
Same as it ever was, same as it ever was

Water dissolving and water removing
There is water at the bottom of the ocean
Under the water, carry the water
Remove the water from the bottom of the ocean
Water dissolving and water removing

Letting the days go by, let the water hold me down
Letting the days go by, water flowing underground
Into the blue again, into the silent water
Under the rocks and stones, there is water underground

Letting the days go by, let the water hold me down
Leting the days go by, water flowing underground
Into the blue again, after the money’s gone
Once in a lifetime, water flowing underground

You may ask yourself, “What is that beautiful house?”
You may ask yourself, “Where does that highway go to?”
And you may ask yourself, “Am I right, am I wrong?”
And you may say to yourself, “My God, what have I done?”

Letting the days go by, let the water hold me down
Letting the days go by, water flowing underground
Into the blue again, into the silent water
Under the rocks and stones, there is water underground

Letting the days go by, let the water hold me down
Letting the days go by, water flowing underground
Into the blue again, after the money’s gone
Once in a lifetime, water flowing underground

Same as it ever was, same as it ever was
Same as it ever was, look where my hand was
Time isn’t holding up, time isn’t after us
Same as it ever was, same as it ever was
Same as it ever was, same as it ever was
Same as it ever was, same as it ever was (I couldn’t get no rest)
Same as it ever was, hey let’s all twist our thumbs

Here comes the twister
Letting the days go by (same as it ever was, same as it ever was)
Letting the days go by (same as it ever was, same as it ever was)
Once in a lifetime, let the water hold me down
Letting the days go by, water flowing underground


3,717 posted on 07/11/2024 7:25:16 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 3716 | View Replies]

To: PIF; All

S it up RuZZian Boys.

“Russia Vows ‘Military Response’ to U.S. Missile Deployments in Germany”

“The U.S. and Germany announced episodic deployments of longer-range American missiles in Germany starting in 2026.”

“Russia is preparing military countermeasures in response to the planned American deployment of longer-range missiles in Germany, the Russian deputy foreign minister said on Thursday, adding that the U.S. move was “destructive to regional safety and strategic stability.”

“Without nerves, without emotions, we will develop a military response, first of all, to this new game,” the deputy minister, Sergei A. Ryabkov, told Interfax, a Russian news agency.

In a separate comment published by the Russian Foreign Ministry, Mr. Ryabkov said that Moscow had anticipated the decision and that Russia had started preparing “compensating countermeasures” in advance.

In a joint statement, the United States and Germany said Washington would begin “episodic deployments” of the missiles in Germany in 2026, including those that are “significantly longer range” than the ones currently deployed throughout Europe.”

https://archive.ph/5W2u8


3,718 posted on 07/11/2024 7:59:23 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 3717 | View Replies]

To: PIF; All

“Exclusive: US and Germany foiled Russian plot to assassinate CEO of arms manufacturer sending weapons to Ukraine”

“US intelligence discovered earlier this year that the Russian government planned to assassinate the chief executive of a powerful German arms manufacturer that has been producing artillery shells and military vehicles for Ukraine, according to five US and western officials familiar with the episode.

The plot was one of a series of Russian plans to assassinate defense industry executives across Europe who were supporting Ukraine’s war effort, these sources said. The plan to kill Armin Papperger, a white-haired goliath who has led the German manufacturing charge in support of Kyiv, was the most mature.

When the Americans learned of the effort, they informed Germany, whose security services were then able to protect Papperger and foil the plot. A high-level German government official confirmed that Berlin was warned about the plot by the US.”

https://www.cnn.com/2024/07/11/politics/us-germany-foiled-russian-assassination-plot/?dicbo=v2-g759tia&hpt=ob_blogfooterold


3,719 posted on 07/11/2024 8:13:04 AM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 3718 | View Replies]

To: BroJoeK

“Since the end of 2022, Russians have conquered another roughly 300 square miles of Ukraine, at a cost of circa 400,000 casualties.”

Wow. That really puts it into perspective. No way that is sustainable.

On this thread, we have been tracking the drawdown of the old Soviet stockpiles (10 more tanks today) and have noted that as they have been expended (the better gear first), Russian casualty rates have continued to increase.

As we see with their “meat waves” and smaller unit actions (now mostly squad size), as their firepower declines, they become an increasingly Light Infantry force on the ground.

In general, historically, Infantry accounts for 80-85% of casualties, and Artillery inflicts the majority of casualties. As Russia’s Artillery advantage continues to decline (from over 20-1 early in the war, to around 5-1 today, with parity in some places, like Kharkiv), and their force becomes more Infantry based, it seems likely that the increasing trend in Russian casualties (from around 300 per day, up to around 1,000 per day now) will continue to worsen.


3,720 posted on 07/11/2024 8:28:41 AM PDT by BeauBo
[ Post Reply | Private Reply | To 3712 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 3,681-3,7003,701-3,7203,721-3,740 ... 4,861-4,874 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson