Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deathcult; deepinthespamforest; delusionalzeepers; demyanganul; dimwit; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; freeploader; freeploadingspammer; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; saintvolodymyr; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 10,281-10,30010,301-10,32010,321-10,340 ... 20,281-20,292 next last
To: ETCM; AdmSmith

“Russia is also building an air base in Libya”

A big Russian presence will destabilize the balance of power in Libya, between the UN-recognized Government in Tripoli, and the rebels in BenGhazi.

Turkey has been providing direct military support to the Government of National Accord (GNA) in Tripoli - Training, advisers on the ground, Intelligence, direct Air and Naval support, and UAVs. In addition to deploying regular Turkish military units, Turkey has also recruited and provided Syrian mercenaries for the GNA Armed Forces.

So the ongoing Russia-Turkey proxy war seems likely to heat up there.


10,301 posted on 01/03/2025 2:55:44 PM PST by BeauBo
[ Post Reply | Private Reply | To 10299 | View Replies]

To: AdmSmith; PIF; blitz128
The old Soviet Appartchiks in the still Russian-occupied sliver of Moldova, may finally have to come to terms with the fall of the Soviet Union. After all these years, their protected and subsidized little Soviet theme park may finally run out of subsidies (Cuba too).

Kyiv Independent reports:

"The Russian-occupied Transnistria region of Moldova has rejected Chisinau's offer to help the region purchase gas via European platforms, Vadim Cheban, head of the state energy company Moldovagaz, said on Jan. 3.

Transnistria instead expects Russia's Gazprom will resume deliveries of natural gas, Cheban told the news outlet IPN.

Russia's state-controlled energy giant Gazprom halted gas deliveries to Moldova on Jan. 1, citing alleged unpaid debts by Moldovagaz. The suspension triggered an energy crisis in Transnistria, which now faces industrial collapse due to widespread power outages.

Authorities in Transnistria do not want to purchase gas from the West, claiming this would involve "higher and unstable" energy prices, Cheban said. (Capitalism!)

Moldova had previously offered to assist Transnistria in securing energy resources via European platforms to mitigate the crisis.

Transnistrian officials rejected the offer and said they believe Gazprom will resume Russian gas supplies, Cheban reported.

Russian troops have occupied Transnistria since the early 1990s.

While the rest of Moldova has switched to European energy supplies, the region is heavily dependent on Russian gas... shortages have left nearly 75,000 households without gas and another 116,000 with reduced supply. (out of a population of about 400,000)"

Statue of Vladimir Lenin (Breaking wind) seen in front of Presidential Palace in Tiraspol, the capital of the Russian-occupied breakaway region of Transnistria in Moldova.

10,302 posted on 01/03/2025 3:16:52 PM PST by BeauBo
[ Post Reply | Private Reply | To 10252 | View Replies]

To: AdmSmith; PIF; blitz128

Bad JuJU in South Soviet Disneyland Too (Cuba).

“HAVANA, Jan 2 (Reuters) - In their New Year predictions, high priests from Cuba’s Afro-Cuban Santeria (VooDoo) religion told followers on Thursday to watch their health and spending, care for their families, guard against crime and drink less alcohol amid a punishing economic crisis entering its sixth year.

“Measures must be taken against increasing delinquency,” said the Letter of the Year by high priests, known as Babalawos, from the government-recognized Yoruba Association of Cuba and publicly presented on Thursday in Havana. (Somewhat like the government-recognized FSB officers in robes running the Russian Orthodox Church, but spicier, and better dancers.)

The letters are a prophecy of misfortune, disease and other events and how to cope with them, which Santeria followers anxiously await every year.

Millions of Cubans practice the ritual-filled religion, which fuses Catholicism with ancient African beliefs brought to Cuba by slaves...

...The priests’ forecasts come five years into an economic crisis that has stricken Cubans with worsening shortages of food, medicine, fuel and other goods amid power and water outages and crumbling public transportation and garbage collection.

The island nation’s Communist government blames the economic crisis mainly on U.S. sanctions while admitting it has made mistakes in managing the crisis....

...Babalawo Lazaro Cuesta, of the independent Organizing Commission of the Letter of the Year Miguel Febles Padron, said at another press conference a few miles (km) away that its message signaled many of the same dangers ahead, but also the need for the government to let go of a vision and methods dating back to the Cold War.”

(Cuba has been having widespread electrical blackouts in recent months, with the whole National Grid going down at times - people have noticed.)


10,303 posted on 01/03/2025 3:45:32 PM PST by BeauBo
[ Post Reply | Private Reply | To 10302 | View Replies]

To: BeauBo

A population of 400,000 or less and 191,000 households. Looks like not much reproducing is going on. No wonder the article at Wiki showed the population as shrinking.


10,304 posted on 01/03/2025 3:54:47 PM PST by gleeaikin (in Question authority as you provide links )
[ Post Reply | Private Reply | To 10302 | View Replies]

To: PIF

2 dashes works!


10,305 posted on 01/03/2025 4:31:31 PM PST by dennisw
[ Post Reply | Private Reply | To 10294 | View Replies]

To: gleeaikin

“the article at Wiki showed the population (in Transnistria) as shrinking.”

Maybe some more will move away because of the power and gas problems, and business shutdowns. That seems likely if it drags on in Winter.

About 30% of the People in Transnistria are Russian. Maybe some of them will emigrate back to Mother Russia.


10,306 posted on 01/03/2025 4:32:22 PM PST by BeauBo
[ Post Reply | Private Reply | To 10304 | View Replies]

To: BeauBo

13 Hours: The Secret Soldiers of Benghazi -—— Great movie I have seen a few times.

Free at Amazon Prime.


10,307 posted on 01/03/2025 4:42:48 PM PST by dennisw
[ Post Reply | Private Reply | To 10301 | View Replies]

Hillary says, Since Russia is clearly backing republicans, why don't we ask China to back us?"

"China, if you're listening, why don't you get Trump's tax returns? I'm sure our media would RICHLY reward you." pic.twitter.com/KYZAjIbGFd— Johnny Midnight ⚡️ (@its_The_Dr) January 3, 2025


10,308 posted on 01/03/2025 5:09:34 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 10295 | View Replies]

To: dennisw

“13 Hours: The Secret Soldiers of Benghazi”

I saw that too.

Another casualty of Obamunism’s Arab Spring, and having the Clinton Crime Family in Charge of foreign policy.

Russia ramping up in Libya is not going to help that country stabilize.

81 year old Field Marshall Khalifa Haftar, who runs the rebel areas in the East (BenGhazi, Tobruk), is an interesting character. He was part of the military coup that brought Moammar Gadhafi to power, but later turned against him and moved to the USA - where he lived in Langley, Virginia (where the CIA Headquarters happens to be) for about twenty years, and became a dual Libyan/American citizen. He also speaks Russian (as well as Arabic, English and Italian), and is a graduate of the 3 year Frunze Military Academy in Moscow (roughly the equivalent of the US Command and General Staff College at Fort Leavenworth, KS).


10,309 posted on 01/03/2025 6:35:46 PM PST by BeauBo
[ Post Reply | Private Reply | To 10307 | View Replies]

To: AdmSmith; ETCM

Finnish court upholds seizure of Russian tanker suspected of cable sabotage

Kyiv Independent reports:

“The Helsinki District Court ruled on Jan. 3 to uphold Finland’s seizure of the Russian Eagle S oil tanker, denying an appeal to release the ship and its crew.

Finnish authorities allege the ship damaged a crucial undersea power cable, possibly in an act of sabotage. Estlink 2, a 170-kilometer (106-mile) cable connecting Estonia and Finland, was seriously damaged on Dec. 25.

The Eagle S is believed to be part of Russia’s so-called “shadow fleet,” a group of tankers Moscow uses to circumvent sanctions, including a Group of Seven (G7) price cap on Russian oil...

...Finnish police initially seized the tanker on Dec. 28, considering the vessel to be evidence in a criminal investigation. Caravella LLC FZ, the ship’s United Arab Emirates-based owner, applied to the court to have the seizure lifted.

Police requested the trial be held in secret and court documents kept confidential.

Finnish investigators are currently interrogating Eagle S crew members about the alleged incident. Authorities expect the initial phase of the investigation to last several weeks, and for the entire investigation to conclude in several months.

Three Finnish companies are also demanding the seizure of the tanker in order to secure compensation for damage to the cable. These include national grid operator Fingrid, telecommunications firm Elisa, and state-owned network company Cinia.

Following the cable incident, NATO pledged to enhance its military presence in the Baltic Sea.”


10,310 posted on 01/03/2025 7:17:27 PM PST by BeauBo
[ Post Reply | Private Reply | To 10297 | View Replies]

To: gleeaikin

Russian Offensive Campaign Assessment, January 3, 2025

The Russian Ministry of Defense (MoD) continues to support its official “Glaz/Groza” reconnaissance and strike unit coordination software package despite Russian soldiers’ continued reliance on other ad hoc communications systems. Russian MoD-run television network TV Zvezda broadcasted Russian soldiers at the Mikhailovsky Military Artillery Academy in St. Petersburg training on the “Glaz/Groza” combat operations coordination software, which provides organized command and control (C2) functions to Russian units on the frontline.[62] Russian forces have largely relied on ad hoc communications systems to coordinate combat operations in Ukraine via social media messaging applications, and a former Russian Storm-Z instructor and milblogger previously claimed that the Russian MoD has not introduced its official “Glaz/Groza” application at a wide enough scale for Russian forces to adopt.[63]

Russian soldiers continue to complain that Russian military commanders are abusing soldiers and hiding high casualty rates. Russian opposition outlets Astra and Mobilization News reported on January 3 that Russian officers of military unit 29593 (either the 1440th Motorized Rifle Regiment or the 1194th Motorized Rifle Regiment [reportedly of the 6th Motorized Rifle Division, 3rd Army Corps]) are confiscating the personal phones of soldiers and forcing injured soldiers to pay their platoon commanders 20,000 to 50,000 rubles (about $181 to $452) in order to receive treatment at hospitals.[64] The opposition outlets reported that the Russian command of the unit may have transferred injured soldiers to “unit 44744” – which may be a fake unit – in order to hide the high casualty rates of unit 29593.[65] ISW has observed prior reports of Russian officers physically abusing subordinates and extorting them for money, likely due to poor command training and discipline.[66]

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-january-3-2025


10,311 posted on 01/04/2025 2:09:50 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10252 | View Replies]


10,312 posted on 01/04/2025 2:13:25 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10090 | View Replies]


10,313 posted on 01/04/2025 2:17:22 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10253 | View Replies]

To: FtrPilot

Ukrainian Su-27 Flanker Pilot’s Rare Account Of The Changing Air War
The rare interview details combat operations over Ukraine, including the employment of Western guided munitions from Su-27 Flankers.
https://www.twz.com/air/ukrainian-su-27-flanker-pilots-rare-account-of-the-changing-air-war


Ukraine’s Su-25s Seen Launching Hammer Rocket-Boosted Bombs For The First Time
A video compilation provides a unique look at the French-made Hammer munition being used by Ukrainian Su-25 Frogfoot ground-attack jets.
https://www.twz.com/air/ukraines-su-25s-seen-launching-hammer-rocket-boosted-bombs-for-the-first-time


New Armor Kits Being Installed On Ukraine’s Western Air Defense Systems
Ukraine Situation Report: The new armor plates are designed to add some protection for air defenders in their command vehicles.
https://www.twz.com/news-features/new-armor-kits-being-installed-on-ukraines-western-air-defense-systems


10,314 posted on 01/04/2025 3:30:34 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 10188 | View Replies]

To: BeauBo

Very interesting development. To repair such cables (internet?) must take a few weeks and a few million dollars.


10,315 posted on 01/04/2025 3:39:06 AM PST by dennisw
[ Post Reply | Private Reply | To 10310 | View Replies]

To: BeauBo

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Massive Ukrainian Strike & Sabotage Campaign ]

Today [ Jan 03, 8 pm ], there are a lot of interesting updates from the Russian Federation.

Here, Ukrainian forces have launched a new wave of precision strikes targeting key Russian assets, showcasing their ability to disrupt not only the military command chain, but also logistical networks, and challenge Russia’s strategic capabilities.

This series of coordinated attacks employed a combination of HIMARS, Storm Shadow missiles, and innovative drone technology to devastating effect.

Firstly, the Ukrainians decided to strike command posts and troop deployments, and they did it in a particularly effective way. In the Oryol region, they used Storm Shadow missiles to obliterate a military facility, and kill several Russian soldiers and officers.

Then, the Ukrainian forces targeted the main Russian supply hub for the counteroffensive in Kursk, which is situated in Lgov, by destroying a location known for the presence of Russian troops. Lgov was also target of a precision strike with HIMARS, showcasing the level of Ukrainian surveillance and infiltration, which allowed them to hit the local railway station, just moments after fresh Russian reinforcements have arrived.

Ukrainian operators also targeted command centers in Zaporizhzhia, decimating Russian leadership with another HIMARS strike. In one operation, 3 high-ranking enemy officers were eliminated, alongside the destruction of their vehicles, and the subsequent disruption of evacuation efforts, which eliminated any chance of survival of the Russians.

These actions against command posts and troop concentrations aim to weaken Russian coordination and hinder their operational tempo.

Secondly, Ukraine has maintained relentless pressure on Russian logistics, targeting key railway networks to disrupt supply chains critical for Russia’s military operations. Initial explosions in the Voronezh region halted train services, due to extensive rail damage, setting the tone for continued sabotage.

In the Moscow region, additional blasts caused further destruction to the rail network, significantly hindering freight movement. Notably, freight cars designated for military transport were destroyed in Voskresensk, while unidentified saboteurs set electric trains ablaze in Moscow’s suburbs, rendering them unusable.

By systematically crippling Russia’s rail infrastructure, which is an essential backbone of its logistics network, Ukraine has not only delayed the flow of supplies, but also amplified the logistical strain on Russia’s military campaigns.

Thirdly, fuel and oil depots remain a prime target for Ukrainian strikes. Starting with an explosion at a gas station in Grozny, causing local fuel shortage, Ukrainian forces also successfully destroyed the important oil depot in Smolensk with drones, causing a fire that consumed large quantities of lubricants and fuel.

Such an attack directly impacts Russia’s mechanized operations, slowing their ability to mount offensive and maintain supply chains, and forcing them to use infantry without armored support, which causes them even higher losses.

Lastly comes a groundbreaking achievement of which we have already covered the first steps in a previous report. Now we have the first confirmed destructions of 2 Russian Mi-8 helicopters by Ukraine’s Magura V5 naval drones, equipped with missile armament.

The Main Military Intelligence Directorate of Ukraine released footage from one of the drones showing how they dodged fire from the Russian helicopters, before successfully intercepting them. The video shows the confirmed destruction of one helicopter, and the damage to a second one, initially thought to have been able to return to its base.

In a shocking turn, it was later confirmed by a prominent Russian military analyst that the 2nd Mi-8 was also destroyed, when he wished his condolences to the relatives of the members of the 2 helicopter crews. This engagement near Crimea marked a turning point in the dynamics of the war in the Black Sea.

Russian helicopters, once dominant in countering naval drones, are now vulnerable prey. The downing of these aircraft opens the path for Ukrainian naval drones to operate with greater freedom, potentially reshaping the maritime battle even further.

Ukraine’s multifaceted approach deep behind the frontline, targeting command centers, logistics, fuel supplies, and even finding a solution to aerial threats at sea, has dealt severe blows to Russia’s war efforts.

By systematically dismantling critical components of the Russian military infrastructure, Ukraine is forcing Moscow to divert resources, rethink strategies, and operate under mounting logistical strain.


10,316 posted on 01/04/2025 3:39:52 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 10310 | View Replies]

To: PIF
26DEC2024 Essential goods have seen dramatic price hikes since the start of the year [2024], including potatoes (90.5%), onions (46.6%), cabbage (46.6%), and butter (35%).
The Central Bank's aggressive interest rate hikes have drawn criticism, particularly from Russia's military-industrial complex. Sergei Chemezov, CEO of state-owned defense giant Rostec, warned in October that continued rate increases could bankrupt businesses.

However, Central Bank Governor Elvira Nabiullina maintains that the high rate is essential to curb inflation, a view echoed by opposition politician Vladimir Milov. Milov told the Kyiv Independent in November, “Chemezov is right that businesses will have to shut down at such a high rate. Nabiullina is right that the rate cannot be cut because... there will be hyperinflation like in Turkey.”
https://kyivindependent.com/russias-inflation-hits-year-high-driven-by-war-spending-food-price-hikes-rosstat-says/

10,317 posted on 01/04/2025 5:09:53 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10316 | View Replies]

To: AdmSmith

Wonder if they are still importing chemically-made Chinese eggs to deal with any shortage?


10,318 posted on 01/04/2025 5:12:23 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 10317 | View Replies]

To: PIF

There is a guy on YouTube that has a series called china fakes everything


10,319 posted on 01/04/2025 5:19:41 AM PST by blitz128
[ Post Reply | Private Reply | To 10318 | View Replies]

To: BeauBo
Re Russian Shadow fleet:

Last night, Ukrainian UAVs successfully attacked the largest commercial oil and gas seaports in Russia striking the Novatrans facility at the port of Ust-Luga in the Leningrad Oblast (St, Petersburg region).

Location: 59.696610, 28.433319

Debris! The local governor claims all drones were shot down and there was no damage.

https://x.com/UKikaski/status/1875502653507076117
8 sec video

Ust-Luga https://www.vesselfinder.com/?p=RUULU001

10,320 posted on 01/04/2025 5:37:49 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10310 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 10,281-10,30010,301-10,32010,321-10,340 ... 20,281-20,292 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson