Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deathcult; deepinthespamforest; delusionalzeepers; demyanganul; dimwit; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; freeploader; freeploadingspammer; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; saintvolodymyr; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 10,221-10,24010,241-10,26010,261-10,280 ... 20,261-20,275 next last
To: JonPreston

Holy crap!! He was a Ukraine soldier recruiter like the 2nd Trump would be Ass*ssin.

Are Trump assassination attempts connected to these acts of terrorism?? https://t.co/49GPi0G27l— Juanita Broaddrick (@atensnut) January 2, 2025


10,241 posted on 01/02/2025 8:36:35 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 10240 | View Replies]

The New Orleans terrorist donated to Democrats

The Tesla/Trump hotel terrorist wore “Slava Ukraini” shirts

Do the math

https://t.co/GRjZnrm9YK— DC_Draino (@DC_Draino) January 2, 2025


10,242 posted on 01/02/2025 8:46:34 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 10241 | View Replies]

To: JonPreston

Glad to see you are on top of things. Vlad might re-enroll you in the Kremlin’s payment plan for Americanski.


10,243 posted on 01/02/2025 9:44:20 AM PST by dennisw
[ Post Reply | Private Reply | To 10241 | View Replies]

To: dennisw
Still with the dopey "he's a Russian!" blather?

Is it any wonder why you'll always be our very own Denny Dimwit?

10,244 posted on 01/02/2025 10:28:26 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 10243 | View Replies]

To: gleeaikin

Russians are likely sabotaging equipment to avoid crossing the Dnipro near Kherson, according to “ATESH.”

Partisans report that in Lazurne, Russian occupiers complain about a sharp increase in equipment breakdowns arriving at repair bases, including boats and jet skis.
https://x.com/wartranslated/status/1874891746070479343


10,245 posted on 01/02/2025 10:59:26 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10238 | View Replies]

Ukrainian soldiers are using drones and artillery to destroy Russian marines from the 61st Brigade who were trying to attack the right bank of the Kherson region. The video shows that one of the Russian marines surrendered and shot himself in the head. Kherson region.

https://x.com/catdorina/status/1874902225732169920
30 sec video


10,246 posted on 01/02/2025 11:49:52 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10245 | View Replies]

To: AdmSmith

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ New Russian Offensive Fails Miserably. Troops Scattered & Destroyed ]

Today [ Jan 02, 8 pm ], there are a lot of updates from the Lyman direction.

Here, Russian forces launched a renewed wave of assaults on Terny, hoping to capitalize on high ground and forest cover to break Ukrainian defenses.

Instead, their overextended logistics and exposed positions became fatal vulnerabilities, as Ukrainian forces immobilized their armored column, and systematically eliminated the stranded troops in a devastating counteraction.

The Russian military launched this recent new wave of frontal assaults to capture the Ukrainian-held settlement of Terny, with the clear goal of seizing it and consolidating control over the east bank of the Zherebets River.

Achieving this [ objective ] would allow Russia to advance toward Lyman, putting additional pressure on Ukrainian forces to support the broader Russian offensive objectives in the Donbas region by forcing the Ukrainians to overstretch their defense.

The Russians had previously failed to take Terny with attacks from the north, and after suffering losses were forced to take an operational pause which they used to regroup and prepare. This time, they launched their assault from the east, utilizing the cover of a small forest to minimize Ukrainian crossfire and exploit the long and narrow layout of Terny, which makes the village naturally harder to defend from the east.

Attacking from the high ground offered another tactical advantage for the Russians, providing them with better lines of sight and potential dominance over the battlefield. However, despite these benefits, 2 significant challenges undermined their operation.

Firstly, logistics proved to be a critical weakness for the Russians, as while advancing, their forces were stretched thin, relying on supply lines that extended over 16 kilometers from the nearest settlements around Kreminna. This distance left their units vulnerable to disruption and delayed the delivery of ammunition, equipment, and reinforcements.

Secondly, the open fields surrounding the approach to Terny also worked against them, exposing their movements to early detection by Ukrainian reconnaissance drones.

In order to prepare as best as possible, and exploit vulnerabilities in Ukrainian defense lines, the Russians started conducting small probing assaults involving teams of between 2 and 4 soldiers. Soon Ukrainian military observers stated that Russian forces had increased their efforts and were now attacking in squads of 10 to 15 soldiers with the support of armored vehicles.

Ukrainian forces, being on high alert, capitalized on the Russian disadvantages with a well-coordinated defense. Using real-time intelligence from drones with thermal vision, they identified enemy troop movements far in advance.

Geolocated footage from one attempt shows how a Russian advancing unit moves along a tree line, but is quickly targeted by the Ukrainians with artillery, inflicting significant casualties before they can even reach the frontline. Survivors are then hunted down with the help of grenades dropped by drones.

Another example of how Ukrainians engaged the attackers early, and exploited the overstretched logistics to successfully neutralize the Russian offensive before it gained momentum was published by drone operators of the Ukrainian 60th Mechanized Brigade.

The footage starts with 2 Russian BMPs moving quickly and close to the forest to remain undetected by the defenders in Terny. Unfortunately for the Russians, the Ukrainians used a drone to target one of the leading armored vehicles. After it caught fire, the Russian soldiers on board jumped to seek cover in the trees.

The other BMP continued a bit further, before also being hit by an FPV drone. With panic kicking in, the driver turned the vehicle and started heading back. The Russians in the trees were left without armored support and under close Ukrainian watch from the sky, which prompted a rain of grenades and kamikaze drones that eliminated them and cleared the forest.

Overall, the renewed Russian attempt to take Terny failed at its very beginning. Their inability to adapt to logistical constraints and counter Ukrainian defense measures, left them unable to achieve their strategic objectives.

For now, Terny remains firmly under Ukrainian control, and the bridgehead on the east bank of the Zherebets River continues to serve as a key position for Ukraine’s defense in the Lyman sector.


10,247 posted on 01/02/2025 12:51:21 PM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 10246 | View Replies]

To: AdmSmith

“The Pro-Russian Moldovan region of Transnistria has shut down all industrial enterprises due to a lack of energy resources, according to the “government” of the unrecognized republic.”

https://x.com/NOELreports/status/1874873562185773367

Transnistria’s entire economy was based on free Russian gas. Looks like Russia is hoping Transnistria’s complete collapse will cause the Moldovan government to fall, to be replaced with a Russian puppet. Either way it seems reintegration with Moldova is likely. They can’t survive on their own.


10,248 posted on 01/02/2025 12:55:11 PM PST by ETCM (“There is no security, no safety, in the appeasement of evil.” — Ronald Reagan)
[ Post Reply | Private Reply | To 10246 | View Replies]

To: ETCM

Population about 368,000, no more than a city.
https://en.wikipedia.org/wiki/Transnistria


10,249 posted on 01/02/2025 1:11:18 PM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10248 | View Replies]

To: AdmSmith

Appears the 🍈 has a lot on his mind lol


10,250 posted on 01/02/2025 3:49:34 PM PST by blitz128
[ Post Reply | Private Reply | To 10245 | View Replies]

To: PIF; AdmSmith

“Putin Death watch begins.”

OSINTdefender @sentdefender

“According to the Russian Telegram Channel, General SVR; the Former President of Syria, Bashar al-Assad fell deathly ill at his Moscow Apartment on Sunday, with him beginning to “Cough Violently and Choke” after calling for Medical Assistance. Tests are claimed to have revealed that he had been Poisoned, with him having been treated at his Home, where he is now in Stable Condition.”


10,251 posted on 01/02/2025 7:13:28 PM PST by BeauBo
[ Post Reply | Private Reply | To 10235 | View Replies]

To: gleeaikin

Russian Offensive Campaign Assessment, January 2, 2025

Gazprom is likely attempting to exploit the cessation of gas transits through Ukraine to create an artificial energy crisis to destabilize Moldova. Gazprom shut off gas supplies to Transnistria via Ukraine on January 1, claiming that Moldova failed to pay a debt worth $709 million.[6] An audit by British and Norwegian audit firms, however, found in 2022 that Moldova owed Gazprom only $8.6 million.[7] Moldova recently held talks with Gazprom about transporting gas to Transnistria via the TurkStream pipeline that runs from Russia to Turkey, but Gazprom refused and did not make the arrangements to do so by the deadline on December 16.[8] Free Gazprom gas has long powered Transnistria’s Cuciurgan power station, which exported a significant amount of electricity to Moldova and used the profits from these sales to support Transnistria’s budget.[9] The Cuciurgan power station switched to coal reserves on January 1, which reportedly can last about 50 days.[10] Transnistrian gas company Tiraspoltransgaz stopped gas supplies to most consumers in Transnistria and shut off most of the hot water and heat on January 1.[11] Moldova increased its electricity imports from Romania to make up for lost supplies from Transnistria.[12] Moldovan gas company Moldovagaz and Moldovan state electricity company Energocom offered on January 1 to provide Tiraspoltransgaz technical and commercial assistance to obtain gas from European markets after successful tests on December 31, 2024 to supply Moldova with gas through Bulgaria, Romania, and Ukraine.[13]

The Russian Ministry of Defense (MoD) continues to inadequately supply Russian military personnel with basic equipment and ammunition, forcing soldiers to provide their own materiel. Russian milbloggers claimed on January 1 that Russian forces are currently suffering from a widespread shortage of smoothbore small arms, such as 12-guage shotguns, commonly used to defend against first-person view (FPV) drones on the frontlines.[99] The milbloggers claimed that Russian evacuation teams regularly have only one or no smoothbore guns when evacuating wounded personnel and that Russian forces are forced to purchase their own small arms and ammunition despite the Russian MoD’s previous efforts to address the small arms shortage on the frontlines. Another Russian milblogger, citing sources inside Rosgvardia, claimed that a previous effort to send hundreds of thousands of small arms that Russian authorities had confiscated from Russian civilians to Russian military units fighting in Ukraine did not solve the arms shortage issue.[100] The milblogger claimed that the Russian MoD and Rosgvardia did not cooperate and coordinate so neither entity transferred the arms to front line units en masse.[101] Another Russian milblogger disputed these claims, alleging that Russian servicemembers stated that they have received many confiscated smoothbore small arms.[102] Russian opposition media outlet Mobilization News posted footage on January 2 showing Russian servicemembers complaining about ongoing shortages of basic supplies and armaments[103] The Russian servicemembers stated that Russian personnel are regularly forced to purchase their own food and military equipment to make up for shortages.

Russia and Iran will likely sign a strategic partnership agreement that includes defense and military technological provisions in mid-January 2025. Russian state news outlet Izvestia reported on December 26 that Iranian President Masoud Pezeshkian is expected to sign a Comprehensive Strategic Partnership Agreement with Russia in Moscow on January 17, and the Iranian Embassy in Moscow and Russian Foreign Minister Sergei Lavrov confirmed on January 2 that the visit will occur.[104] Israeli news outlet Ynet reported that the deal likely includes provisions for Russia to supply Iran with Su-35 fighter jets, technology transfers for missile and military satellites production, and advanced defense systems like the S-400.[105] Ynet reported that Iran likely plans to send shipments of upgraded Iranian strike drone models to Russia in return. A Russian milblogger speculated on January 2 that Iran is preparing to transfer Fath-360 short-range ballistic missiles and Arman or Ababil air defense missile systems to Russia from the Bandar Anzali port on the Caspian Sea.[106] One milblogger claimed that Russia presumably purchased the missile and air defense systems from Iran, but another milblogger claimed that the images of the alleged preparations for these missile transfers do not fully resemble the Iranian Fath-360 and dismissed the speculation.[107]

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-january-2-2025


10,252 posted on 01/02/2025 11:58:01 PM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10173 | View Replies]


10,253 posted on 01/03/2025 12:08:15 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10214 | View Replies]

To: gleeaikin; PIF; blitz128; FtrPilot; BeauBo; USA-FRANCE; canuck_conservative; marcusmaximus; ETCM
Fact of the day: Did you know Vladimir Putin is often thought to be much taller than he really is? Despite his commanding presence in Russian propaganda, he's actually only 130 cm tall!

https://x.com/sadepiippu/status/1874480339432960281

Putin wears high heels. Putin's Napoleon complex or how to look 15 cm taller.

https://www.youtube.com/watch?v=lY6lHjZjYXE

3 min video

10,254 posted on 01/03/2025 12:14:25 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10253 | View Replies]

To: PIF

Кремлевская табакерка:

Putin was offered to strike Erdogan three times

Hawks in Vladimir Putin’s entourage are unhappy with the latest actions of Turkish President Erdogan. It is worth noting that our authorities did not develop tense relations with Turkey today. Nevertheless.

The first really unpleasant blow was in Nagorno-Karabakh - then Turkey helped Azerbaijan seize the disputed territories, while putting pressure on Moscow’s leading positions in the region. After the start of the SVO, Turkey treacherously closed the Bosphorus for the passage of Russian ships, while providing military assistance to Ukraine. Most recently, Erdogan squeezed Assad out of Syria , provoking another crisis for Russia. We should not forget Erdogan’s desire to gain control of Crimea . Can he be called our ally or partner after this?

According to our information, dissatisfaction with Erdogan’s position is growing in Vladimir Putin’s entourage. Rumor has it that there is a certain plan. The goal of this plan is to put Erdogan in his place and strengthen our positions.

Point one - close Turkey to Russian tourists. Point two - stop importing Turkish fruits and vegetables to Russia. And point three - a comprehensive military strike, which includes pressure on Turkey in the Black Sea. Sources say that the proposed measures include breaking through the Bosphorus by Russian military vessels. It is not yet clear when this plan will be proposed to Vladimir Putin. But it is worth noting that there are some good proposals there. Erdogan has really gotten cheeky!

https://t.me/kremlin_secrets/5119


10,255 posted on 01/03/2025 12:22:03 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10254 | View Replies]

To: AdmSmith

“the proposed measures include breaking through the Bosphorus by Russian military vessels.”

That would be like shooting fish in a barrel for Turkey, and should trigger Article 5 of NATO.


10,256 posted on 01/03/2025 1:48:02 AM PST by BeauBo
[ Post Reply | Private Reply | To 10255 | View Replies]

To: AdmSmith

“Only” 1,080 casualties and one tank lost?

Maybe bad weather slowed Operations, but it is looking like their offensive drive of recent months may be culminating.


10,257 posted on 01/03/2025 2:04:15 AM PST by BeauBo
[ Post Reply | Private Reply | To 10253 | View Replies]

To: AdmSmith

Speaking of Nat gas, this morning on financial program, a pundit said the US has maxed out on NG export, until 5 new terminals come on line in 2028.


10,258 posted on 01/03/2025 3:28:54 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 10252 | View Replies]

To: AdmSmith

And point three - a comprehensive military strike, which includes pressure on Turkey in the Black Sea. Sources say that the proposed measures include breaking through the Bosporus by Russian military vessels.


And so NATO responds. Is Putin really that much of a genius?


10,259 posted on 01/03/2025 3:31:51 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 10255 | View Replies]

To: BeauBo

Maybe not counting Nork dead?


10,260 posted on 01/03/2025 3:32:28 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 10257 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 10,221-10,24010,241-10,26010,261-10,280 ... 20,261-20,275 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson