Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

To: BeauBo

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Massive Ukrainian Strike & Sabotage Campaign ]

Today [ Jan 03, 8 pm ], there are a lot of interesting updates from the Russian Federation.

Here, Ukrainian forces have launched a new wave of precision strikes targeting key Russian assets, showcasing their ability to disrupt not only the military command chain, but also logistical networks, and challenge Russia’s strategic capabilities.

This series of coordinated attacks employed a combination of HIMARS, Storm Shadow missiles, and innovative drone technology to devastating effect.

Firstly, the Ukrainians decided to strike command posts and troop deployments, and they did it in a particularly effective way. In the Oryol region, they used Storm Shadow missiles to obliterate a military facility, and kill several Russian soldiers and officers.

Then, the Ukrainian forces targeted the main Russian supply hub for the counteroffensive in Kursk, which is situated in Lgov, by destroying a location known for the presence of Russian troops. Lgov was also target of a precision strike with HIMARS, showcasing the level of Ukrainian surveillance and infiltration, which allowed them to hit the local railway station, just moments after fresh Russian reinforcements have arrived.

Ukrainian operators also targeted command centers in Zaporizhzhia, decimating Russian leadership with another HIMARS strike. In one operation, 3 high-ranking enemy officers were eliminated, alongside the destruction of their vehicles, and the subsequent disruption of evacuation efforts, which eliminated any chance of survival of the Russians.

These actions against command posts and troop concentrations aim to weaken Russian coordination and hinder their operational tempo.

Secondly, Ukraine has maintained relentless pressure on Russian logistics, targeting key railway networks to disrupt supply chains critical for Russia’s military operations. Initial explosions in the Voronezh region halted train services, due to extensive rail damage, setting the tone for continued sabotage.

In the Moscow region, additional blasts caused further destruction to the rail network, significantly hindering freight movement. Notably, freight cars designated for military transport were destroyed in Voskresensk, while unidentified saboteurs set electric trains ablaze in Moscow’s suburbs, rendering them unusable.

By systematically crippling Russia’s rail infrastructure, which is an essential backbone of its logistics network, Ukraine has not only delayed the flow of supplies, but also amplified the logistical strain on Russia’s military campaigns.

Thirdly, fuel and oil depots remain a prime target for Ukrainian strikes. Starting with an explosion at a gas station in Grozny, causing local fuel shortage, Ukrainian forces also successfully destroyed the important oil depot in Smolensk with drones, causing a fire that consumed large quantities of lubricants and fuel.

Such an attack directly impacts Russia’s mechanized operations, slowing their ability to mount offensive and maintain supply chains, and forcing them to use infantry without armored support, which causes them even higher losses.

Lastly comes a groundbreaking achievement of which we have already covered the first steps in a previous report. Now we have the first confirmed destructions of 2 Russian Mi-8 helicopters by Ukraine’s Magura V5 naval drones, equipped with missile armament.

The Main Military Intelligence Directorate of Ukraine released footage from one of the drones showing how they dodged fire from the Russian helicopters, before successfully intercepting them. The video shows the confirmed destruction of one helicopter, and the damage to a second one, initially thought to have been able to return to its base.

In a shocking turn, it was later confirmed by a prominent Russian military analyst that the 2nd Mi-8 was also destroyed, when he wished his condolences to the relatives of the members of the 2 helicopter crews. This engagement near Crimea marked a turning point in the dynamics of the war in the Black Sea.

Russian helicopters, once dominant in countering naval drones, are now vulnerable prey. The downing of these aircraft opens the path for Ukrainian naval drones to operate with greater freedom, potentially reshaping the maritime battle even further.

Ukraine’s multifaceted approach deep behind the frontline, targeting command centers, logistics, fuel supplies, and even finding a solution to aerial threats at sea, has dealt severe blows to Russia’s war efforts.

By systematically dismantling critical components of the Russian military infrastructure, Ukraine is forcing Moscow to divert resources, rethink strategies, and operate under mounting logistical strain.


10,316 posted on 01/04/2025 3:39:52 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 10310 | View Replies ]


To: PIF
26DEC2024 Essential goods have seen dramatic price hikes since the start of the year [2024], including potatoes (90.5%), onions (46.6%), cabbage (46.6%), and butter (35%).
The Central Bank's aggressive interest rate hikes have drawn criticism, particularly from Russia's military-industrial complex. Sergei Chemezov, CEO of state-owned defense giant Rostec, warned in October that continued rate increases could bankrupt businesses.

However, Central Bank Governor Elvira Nabiullina maintains that the high rate is essential to curb inflation, a view echoed by opposition politician Vladimir Milov. Milov told the Kyiv Independent in November, “Chemezov is right that businesses will have to shut down at such a high rate. Nabiullina is right that the rate cannot be cut because... there will be hyperinflation like in Turkey.”
https://kyivindependent.com/russias-inflation-hits-year-high-driven-by-war-spending-food-price-hikes-rosstat-says/

10,317 posted on 01/04/2025 5:09:53 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10316 | View Replies ]

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson