Free Republic
Browse · Search
Religion
Topics · Post Article

Like all journalists, Matti Friedman is doing a superficial job and mixing theories like a kid with finger paints. I suggest for a deeper understanding of the conflicting theories, I suggest The Dead Sea Scrolls Deception by Michael Baigent and Richard Leigh (1991, ISBN 0-671-73454-7).

Anyway, here's the link to the web site. I'm definitely bookmarking it: http://dss.collections.imj.org.il/

1 posted on 09/26/2011 2:45:40 PM PDT by Eleutheria5
[ Post Reply | Private Reply | View Replies ]


To: Eleutheria5
Wonderful use of this technology giving these ancient manuscripts mass exposure. Now, demand access to the recently recovered Munich “lost archive” of 450 rolls of film of ancient manuscripts of the Quran held in Germany since WWII – and open them up to equal scholarly scrutiny. http://online.wsj.com/article/SB120008793352784631.html
The 450 rolls of film had been assembled before the war for a bold venture: a study of the evolution of the Quran, the text Muslims view as the verbatim transcript of God's word. The wartime destruction made the project "outright impossible," Mr. Spitaler wrote in the 1970s. .Mr. Spitaler was lying. The cache of photos survived, and he was sitting on it all along. The truth is only now dribbling out to scholars -- and a Quran research project buried for more than 60 years has risen from the grave. "He pretended it disappeared. He wanted to be rid of it," says Angelika Neuwirth, a former pupil and protégée of the late Mr. Spitaler. Academics who worked with Mr. Spitaler, a powerful figure in postwar German scholarship who died in 2003, have been left guessing why he squirreled away the unusual trove for so long . . ."
Unveil this documented history once and for ALL.
2 posted on 09/26/2011 2:58:13 PM PDT by wtd
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Eleutheria5

I’ve studied quite a bit of material about the scrolls and read the translations of the scrolls themselves. They are a great world treasure.


3 posted on 09/26/2011 3:12:00 PM PDT by DonaldC (A nation cannot stand in the absence of religious principle.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: SunkenCiv

Ping!!!


6 posted on 09/26/2011 3:27:51 PM PDT by Outlaw Woman (Back to square freakn' one...)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Eleutheria5
part of a broader attempt by the custodians of the celebrated manuscripts — who were once criticized for allowing them to be monopolized by small circles of scholars

Uhhh. The "custodians" changed beginning in 1967. And there was quite a bit of political momentum to overcome.

ML/NJ

7 posted on 09/26/2011 3:44:42 PM PDT by ml/nj
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Eleutheria5

Digital Dead Sea Scrolls - http://dss.collections.imj.org.il/


10 posted on 09/26/2011 4:02:59 PM PDT by anonsquared
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Eleutheria5

Those originally in possession of the Dead Sea Scrolls refused to share the information (like a bunch of babies not sharing thier new toy). But then one of them gave an outsider what amounts to basically a concordance which listed the order of each word, they guy wrote a program to reproduce the text from that and published, and those the jig was up. The only reason we ever got access to them was this. Ya, it angers me.


15 posted on 09/27/2011 4:58:48 AM PDT by Scythian
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Eleutheria5
this calls for a special search engine: Photobucket
20 posted on 09/27/2011 10:03:59 PM PDT by RitchieAprile
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Eleutheria5; wtd; G8 Diplomat; SunkenCiv; Dajjal
A lot of interesting info will be revealed.

related documents
“Ancient” Syriac bible found in Cyprus
http://www.freerepublic.com/focus/f-religion/2179793/posts

Low profile for German Koran challenger

http://www.freerepublic.com/focus/f-news/1277705/posts

The Syro-Aramaic Reading of the Koran: A Contribution to the Decoding of the Language of the Koran
Christoph Luxenberg
http://www.amazon.com/Syro-Aramaic-Reading-Koran-Contribution-Decoding/dp/3899300882

Review:
Christoph Luxenberg (ps.) Die syro-aramaeische Lesart des Koran; Ein Beitrag zur Entschlüsselung der Qur'ansprache.

http://syrcom.cua.edu/Hugoye/Vol6No1/HV6N1PRPhenixHorn.html

Egyptian Gov. Publication: Questioning the Sanctity of Jerusalem in Islam (MEMRI)

http://www.freerepublic.com/focus/f-news/994949/posts

21 posted on 09/28/2011 3:19:01 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Eleutheria5; Quix; Alamo-Girl
The Great Isaiah Scroll bump!
22 posted on 09/29/2011 10:59:29 PM PDT by .30Carbine
[ Post Reply | Private Reply | To 1 | View Replies ]

Free Republic
Browse · Search
Religion
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson