Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

Russian military convoy has advanced from Ivankiv to outskirts of Kyiv, satellite images show (17 miles long)
CNN ^ | February 28th, 2022 | Paul P. Murphy

Posted on 02/28/2022 8:10:18 PM PST by Mariner

A Russian military convoy that was outside of Ivankiv, Ukraine, on Sunday has since made it to the outskirts of Kyiv, satellite images show.

On Sunday, the convoy was roughly 40 miles northwest of the Ukrainian capital, according to images provided by Maxar Technologies.

Maxar said that roughly 17 miles of roadway is chocked full of the convoy, which consists of armored vehicles, tanks, towed artillery and other logistical vehicles.

The private US company said the convoy was located on the T-1011 highway at Antonov air base around 11:11 a.m local time.

Antonov is roughly 17 miles from the center of the Ukrainian capital.

(Excerpt) Read more at cnn.com ...


TOPICS: Foreign Affairs; News/Current Events; Russia
KEYWORDS: accordingtoplan; aholesandoligarchs; alexanderlukashenko; asplanned; belarus; bidensfolly; chechens; chechnya; coldwarjunkies; deadrussianhomos; deadrussians; deathtochechnya; deathtoputin; deathtorussia; eurowankers; genius; ghostofkiev; globohomo; grannygreenparty; holodomor; isaidbudlight; lakhtabot; lukashenko; maxartechnologies; militarygenius; moldova; momoneymomoney; moskva; mumsiemaximus; natosfailing; newworldorder; nyuknyuknyuk; odesa; odessa; pedosforputin; poordoomedwangers; putin; putinlovertrollsonfr; putinsbuttboys; putinthehomo; putinworshippers; ramzankadyrov; russia; russianaggression; russianatrocities; russianhomos; russiansuicide; russianwarcrimes; russianwarcriminals; scottritter; sergeyshoigu; siloviki; smartandsavvy; theholodomor; tombofbakhmut; tothelastukie; transnistria; trostyanets; trustzelsplan; ukenazistoast; ukraine; vladimirsolovyov; vladtheimploder; vlodtheimpaled; wagnergroup; warinukraine; warpigs; wgafdamant; whiteflagofazov; yevgenyprigozhin; yousankmybattleship; zeeperfap; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovevindman; zelenskyy; zottherussiantrolls
Navigation: use the links below to view more comments.
first previous 1-20 ... 6,281-6,3006,301-6,3206,321-6,340 ... 6,941-6,956 next last
Russian blogger:

The name of the politician who spread rumors about Putin's poor health and death has been named.

We have written about the spread of such rumors more than once. In particular, they appeared after Vladimir Vladimirovich took communion, and also immediately after the terrorist attack in Crocus. Three unrelated sources - in the FSB and the Kremlin - told us that the rumors were dispersed by people associated with Sergei Sobyanin. “We have clear evidence that harmful fake news was spread by people associated with the mayor of Moscow. We are now checking the evidence and will present it to the President. The evidence, believe me, is serious,” said one of the interlocutors.

A source in the Kremlin is confident that Sobyanin has become “a hostage to his ambitions.” “Sergei Semenovich believes that he has stayed too long in his chair in Moscow and wants to reach a higher level. At the very least, become prime minister, but who knows? But he has no chance of getting a post in the same government, so he's doing shit,” he said. Also, according to the interlocutor, Sobyanin wants the SVO [invasion of Ukraine] to end as soon as possible (despite all the progress of our army), and he will get back to normal business, even if he remains mayor of Moscow. At the same time, the head of the capital is not ready for any serious rebellion.

Sources close to Sobyanin denied this information to us and called it “nonsense.” True, we got very nervous and tried to find out where we learned this “nonsense”. It is interesting that Putin has not yet been presented with incriminating evidence against Sobyanin. But sources promise that he will receive all the necessary information in the near future.

https://t.me/kremlin_secrets/4021

6,301 posted on 05/01/2024 11:49:49 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6281 | View Replies]

To: gleeaikin
Russian blogger:

Philosopher Dugin is being blackmailed by an “old friend.” Threatens to give an interview about him to Tucker Carlson and show him an “interesting video.”

Alexander Dugin found himself in an unpleasant situation. He is being blackmailed by an old acquaintance - the leader of the group “Korrozia Metalla” Sergei (“Spider”) Troitsky.

According to our sources close to Troitsky, after his group started having problems , the musician turned to Dugin for help. Specifically, he asked Alexander Gelyevich to use his influence in the Kremlin and make sure that the group stopped being persecuted. “Spider” referred to old friendships with Dugin and the fact that he always liked the work of “Metal Corrosion.” And he asked “to resolve the issue through Putin, there's only five minutes to do.”

Alexander Gelyevich, according to people close to Troitsky, simply “sent” him. As a result, the leader of Metal Corrosion threatens to take extreme measures.

“Spider has several interesting videos from our frenzy, which Dugin was present at. There's a lot of stuff there. And drugs, and a lot of booze, and gangbangs, and pedophilia. And Nazi symbols, of course. There were times when our respected philosopher did not disdain either children or men after coke. He also zigged so funny, naked. When I watch these videos, I always laugh,” one of the band's musicians told us.

Troitsky is not just threatening to publish these videos. He promised to contact Tucker Carlson, who recently published an interview with Dugin. And show all the incriminating evidence on the air of his program, giving an interview on this topic. “Spider” is sure that the journalist will be interested in such videos. And, if not, then “there are many different other American television channels.” Sources close to Dugin refuse to comment on the existence of compromising videos. But they admit that Alexander Gelievich is being blackmailed by “some unreasonable people.”

We think we will determine whether this blackmail will be successful for Troitsky by whether they continue to pursue “Korrozia Metalla.” And will the group resume its activities?
https://t.me/kremlin_secrets/4025

https://www.metal-archives.com/bands/%D0%9A%D0%BE%D1%80%D1%80%D0%BE%D0%B7%D0%B8%D1%8F_%D0%9C%D0%B5%D1%82%D0%B0%D0%BB%D0%BB%D0%B0/441

On 29 April 2024 the band members were arrested during a live show in Nizjnij Novgorod for displaying neo-Nazi symbols and selling neo-Nazi books and clothes which is illegal in Russia. The band said it's “old Slavic symbols.
https://en.wikipedia.org/wiki/Korrozia_Metalla

6,302 posted on 05/02/2024 4:23:23 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6231 | View Replies]

GUR named the approximate stocks of missiles in Russia:

• 40 Zircon: production rates - up to 10 missiles/month;
• 400 Onyx/Onyx-M: production rate – up to 10 missiles/month.
• 270 Kalibr: production rate – 30-40 missiles/month.
• 45 Kh-69: production rate – 1-3 missiles/month.

https://bsky.app/profile/maks23.bsky.social/post/3krgrsmtgnk2t


6,303 posted on 05/02/2024 5:21:17 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6302 | View Replies]


6,304 posted on 05/02/2024 10:18:04 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6299 | View Replies]

Russian Offensive Campaign Assessment, May 2, 2024

The US Department of State (DoS) announced on May 1 that it has determined that Russian forces are violating the Chemical Weapons Convention (CWC), to which Russia is a signatory. The US DoS stated that it made a determination under the Chemical and Biological Weapons Control and Warfare Elimination Act of 1991 (CBW Act) that Russian forces have used chloropicrin and riot control agents (RCAs) against Ukrainian forces in Ukraine in violation of the CWC.[28] Chloropicrin is a pesticide and lung damaging agent, and Ukrainian officials have previously reported that Russian forces are increasingly equipping grenades with chloropicrin.[29] Russian forces have reportedly extensively used chlorobenzylidenemalononitrile (CS) gas, a type of RCA, in grenades dropped from drones on Ukrainian positions throughout the frontline.[30] The US DoS noted that Russian forces likely use chemical weapons in an effort to dislodge Ukrainian forces from fortified positions and achieve tactical gains.[31] Kremlin Spokesperson Dmitri Peskov denied the US DoS determination and claimed on May 2 that Russia is abiding by its obligations to the CWC.[32] ISW previously observed the Russian 810th Naval Infantry Brigade acknowledge in a now-deleted post that elements of the brigade deliberately used K-51 grenades with CS gas on Ukrainian positions near Krynky in east (left) bank Kherson Oblast in December 2023.[33] The US DoS also announced sanctions against the Russian Ministry of Defense's (MoD) Radiological, Chemical, and Biological (RCB) Defense Forces; the stated-owned Scientific Research Institute of Applied Acoustics; and the MoD’s 48th Central Scientific and Research Institute as well as four Russian companies for their involvement in the development and use of chemical weapons.[34]

Russian President Vladimir Putin met with Tula Oblast Governor and known Wagner Group-affiliate Alexei Dyumin on May 2, further indicating that Putin may be seeking to reduce Russian Defense Minister Sergei Shoigu’s power by balancing him with rivals. Dyumin notably briefed Putin about Tula Oblast’s contributions to Russia's full-scale invasion of Ukraine at the presidential estate in Novo-Ogaryovo, Moscow Oblast.[39] Dyumin focused on three topics: support and housing for participants of Russian military personnel fighting in Ukraine, improvements to the Russian defense industrial base (DIB) and improving the medical system in Tula Oblast. Dyumin claimed that the Tula Oblast administration is cooperating with the Russian MoD to fully equip Russian military units with necessary materiel identified by the local commanders. Dyumin also boasted that Tula Oblast opened one of the first training centers for drone operators in cooperation with the Russian MoD to support the Russian MoD and other security agencies’ interests. Dyumin emphasized the Tula Oblast administration's commitment to producing weapons and supporting Russia's industrial base (DIB). Dyumin welcomed Russian Deputy Prime Minister and Minister of Trade and Industry Denis Manturov’s proposal for the federal government to assist with the construction of additional DIB enterprises and bragged about Russia's increasing DIB production capabilities. Dyumin’s brief appeared to be an attempt to win Putin's favor following Dyumin’s notable fall from Putin's grace during Wagner Group Yevgeny Prigozhin’s mutiny in late June 2023.[40] Dyumin repeatedly sided with Prigozhin throughout 2022 and 2023 reportedly in an attempt to facilitate firings within the Russian MoD and possibly hoping to replace Russian Defense Minister Sergei Shoigu himself.[41]

Putin likely deliberately publicized his meeting with Dyumin following the high-profile arrest of Russian Deputy Defense Minister Timur Ivanov on April 24 and before the presidential inauguration on May 7, possibly to punish the Shoigu-led MoD for failing to accomplish the Kremlin's military goals. The Putin-Dyumin meeting generated a significant amount of discourse within the Russian information space, with numerous milbloggers and political commentators pointing out that the meeting occurred between Ivanov’s arrest and the expected government reshuffle following the inauguration.[42] Russian insider sources speculated that the Kremlin may appoint Dyumin to a new role involving the Russian DIB, such as deputy chairman of the Russian Military Industrial Commission.[43] These speculations may be the result of Dyumin’s hyperfocus on DIB and mention of Manturov during his meeting with Putin. Russian insider sources also interpreted Shoigu’s May 1 statement that Russia needs to increase the volume and quality of weapons and military equipment to ”maintain the required pace of the offensive” during the meeting at the Joint Headquarters of the ”Special Military Operation” on the night of May 1 as a direct attack on certain Russian political figures.[44] (Prigozhin similarly justified Wagner Group's slow and bloody advance in Bakhmut, Donetsk Oblast in winter 2023 with claims of ammunition shortages that he colorfully blamed on Shoigu.) One political commentator claimed that Shoigu is trying to shift the blame for his military and DIB failures onto Manturov and the CEO of Russian state-owned defense conglomerate Rostec, Sergei Chemezov. Another Russian insider source similarly claimed on May 1 that Shoigu heavily criticized Manturov, Rostec, and Deputy Chairman of the Russian Security Council Dmitry Medvedev in response to Ivanov’s arrest.[45] Shoigu reportedly had a particularly close relationship with Ivanov and that Ivanov’s arrest alongside the sudden reemergence to prominence of Dyumin may indicate that the Kremlin is dissatisfied with Shoigu’s performance.[46] One Russian source, however, assessed that Shoigu‘s dismissal is unlikely in 2024.[47]

full report https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-may-2-2024

https://en.wikipedia.org/wiki/Aleksey_Dyumin

6,305 posted on 05/02/2024 11:27:52 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6300 | View Replies]


6,306 posted on 05/02/2024 11:41:50 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6304 | View Replies]

Russian Offensive Campaign Assessment, May 3, 2024

Russian Defense Minister Sergei Shoigu issued a notably candid assessment of recent Russian advances in Ukraine and refrained from sweeping claims about the success of the Russian war effort, possibly in an attempt to temper domestic expectations about Russia's near future successes in Ukraine ahead of the summer 2024 Russian offensive operation. Shoigu claimed during a conference call with Russian military leadership that Russian forces have seized 547 square kilometers of territory in Ukraine since January 1, 2024.[33] ISW has observed evidence confirming that Russian forces have seized approximately 516 square kilometers in 2024 as of April 29, and Shoigu’s claim is notably more realistic than previous claims that surpassed ISW’s assessed Russian advances by roughly 100 square kilometers.[34] Shoigu also reiterated the Russian Ministry of Defense's (MoD) previous claims that Russian forces have seized Novobakhmutivka, Semenivka, and Berdychi and ongoing Kremlin information operations aimed at overestimating Ukrainian manpower and equipment losses.[35]

Shoigu claimed that Russian forces are continuing to break into Ukrainian strongholds along the entire frontline and are forcing Ukrainian forces to retreat from their positions in unspecified areas. Shoigu previously used a similar conference call in December 2023 to downplay Russian operations in Ukraine as an “active defense,” likely in an effort to temper expectations about Russia's forces’ months-long operation to seize Avdiivka.[36] Shoigu may hope to similarly temper domestic expectations about Russian forces anticipated Summer 2024 offensive operation, particularly since Russian forces will be facing better-equipped Ukrainian forces than the Russian military command likely previously expected.
https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-may-3-2024

6,307 posted on 05/04/2024 2:45:28 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6305 | View Replies]


6,308 posted on 05/04/2024 2:47:22 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6298 | View Replies]

Russian blogger:

Have the [Russian] State Duma set their sights on Alaska?

The degree of relations (or rather conflict) between Russia and the United States continues to increase. At a recent closed meeting, the chairman of the State Duma Defense Committee, Andrei Kartapolov, said that we need to be ready to regain the lands of Alaska that historically belonged to Russia.

The statement was received with a bang. The military officers and deputies present agreed that in the context of weakening US hegemony, Russia needs to return control over Alaska.

It is difficult to say whether other representatives of the military elite share such plans. In response to our direct question, the General Staff answered that now we clearly have no time for Alaska. After all, Ukraine is at stake. And we must first finish the SVO with a victory.

https://t.me/kremlin_secrets/4033

6,309 posted on 05/04/2024 2:53:11 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6301 | View Replies]


6,310 posted on 05/04/2024 2:54:12 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6308 | View Replies]


6,311 posted on 05/05/2024 1:49:17 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6306 | View Replies]

Russian Offensive Campaign Assessment, May 4, 2024

Russian law enforcement conducted a search on May 4 of supporters of imprisoned Russian ultranationalist and former officer Igor Girkin (aka Strelkov) in Tula Oblast, possibly in an attempt to set information conditions to ban the movement in Russia. Russian law enforcement officials, including the Federal Security Service (FSB) officials, reportedly conducted a search of the Russian Strelkov (Girkin) Movement (RDS) branch in Tula Oblast on May 4.[17] The RDS reported that Russian law enforcement officials searched the RDS Tula Oblast branch for members of the all-Russian pro-Ukrainian Russian Volunteer Corps (RDK), who were recently found guilty by a local court of inscribing a “Freedom for Strelkov” slogan on a waste heap in Novomoskovsk, Tula Oblast on April 29.[18]

A Russian Telegram channel, which published insider information from law enforcement agencies, reported that Russian law enforcement officials searched at least three RDS members and detained RDS member Alexander Omelchenko. Russian law enforcement officials later released Omelchenko but confiscated his phone. The RDS implied that Russian law enforcement officials are deliberately trying to discredit and ban the movement by claiming that the RDS is affiliated with RDK, which the Russian government has designated as a terrorist organization in Russia. Russian President Vladimir Putin notably recently met with Tula Oblast Governor Alexei Dyumin on May 2, but it is unclear if these two events are related.[19]

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-may-4-2024

6,312 posted on 05/05/2024 4:44:52 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6307 | View Replies]

To: AdmSmith
Russian blogger:

Erdogan wants Crimea again and is “looking forward to the summer.”

The Turkish president does not give up hopes of getting Crimea under his temporary control [https://freerepublic.com/focus/news/4042550/posts?page=5919#5919], sources in the Foreign Intelligence Service say. “Our Turkish friend and partner persists and will once again strive to ensure that Crimea is transferred to Turkish control. We learned that he hopes to take over the peninsula this summer. And he's looking forward to it,” noted one of the interlocutors.

Erdogan’s calculation, in his words, is “simple and cynical.” It is obvious that Ukraine will intensify its attacks on Crimea, especially since it has received and will receive enough weapons for this. As a result, problems may arise in Crimea not only with the holiday season, but also with normal life in general. Against this background, the Turkish president wants to try to “save” the peninsula by taking it under temporary control.

“As far as we know, Erdogan is expecting all sorts of horrors - the death of hundreds of Russian military personnel in Crimea and attacks on almost all of our important facilities. The situation is really not very good, but I am sure that we will cope. And Crimea will not have to be given to anyone,” another intelligence source said on this matter.

https://t.me/kremlin_secrets/4037

6,313 posted on 05/05/2024 4:52:24 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 5919 | View Replies]

To: adorno; alexander_busek; AmericanInTokyo; Apparatchik; ArtDodger; AZJeep; baclava; BeauBo; ...
Russian blogger:

The authorities are preparing a plan to increase the birth rate. One of the ideas is to shorten the gestation period.

Our high-ranking source, speaking on condition of anonymity, told us that the authorities are preparing a plan to increase the birth rate. This should solve the demographic problem that arose in the country long before the SVO. And after the start of the war it got even worse.

The document is still under development, but several key ideas are known.

Firstly, increasing payments for the birth of children. It is no secret that the leaders in birth rates in recent years have been Ingushetia and Dagestan, but the government wants to change the situation in favor of the birth of ethnic Russians. It is proposed to solve the problem by increasing payments to ethnic Russians. In this regard, the opening of such Mother and Child Homes is being discussed, where selected women will become pregnant and give birth to children. But not for himself, but for the state. This project is called “Cuckoo” in closed circles.

Secondly, researchers have been tasked with studying the possibility of giving birth to healthy children not in 9, but conditionally in 8 months. This way, women will be able to give birth more often and faster. If the experiments give a positive result, then they can be scaled up within the framework of the Cuckoo Project.

Thirdly, the government has been tasked with increasing the number of male births in the country. There are no specific proposals yet, but there are rumors that this project is personally supervised by the president's daughter, Maria Vorontsova.[Abortions of female fetuses?]

These are the kind of ideas the government wants. I would like to hear the Church's reaction to such artificial mechanisms for increasing the birth rate of Russians. Our interlocutor emphasized that the result of launching the program will be clear in 5-7 years, but the main thing - the change in the gene pool - should become noticeable in 20-25 years. This should also be affected by restrictions on illegal migrants , which should reduce their number within the country.

https://t.me/kremlin_secrets/4038

We have seen this before in Nazi Germany:

Lebensborn was an SS-initiated, state-supported, registered association in Nazi Germany with the stated goal of increasing the number of children born who met the Nazi standards of “racially pure” and “healthy” Aryans, based on Nazi eugenics (also called “racial hygiene” by some eugenicists). Lebensborn was established by Heinrich Himmler, and provided welfare to its mostly unmarried mothers, encouraged anonymous births by unmarried women at their maternity homes, and mediated adoption of children by likewise “racially pure” and “healthy” parents, particularly SS members and their families.

The Russian tax on childlessnes https://freerepublic.com/focus/news/4042550/posts?page=6285#6285

6,314 posted on 05/05/2024 5:06:53 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6285 | View Replies]


6,315 posted on 05/05/2024 5:39:52 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6310 | View Replies]


6,316 posted on 05/05/2024 5:41:34 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6311 | View Replies]

To: AdmSmith

The monstrosity called Russia must be obliterated.


6,317 posted on 05/05/2024 6:48:12 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 6314 | View Replies]

To: PIF
Yes, and compare this

After the war, the branch of the Lebensborn organisation operating in north-eastern Europe was accused of kidnapping children deemed “racially valuable” in order to resettle them with German families.

https://en.wikipedia.org/wiki/Lebensborn

with the Russian child abductions in Ukraine

https://en.wikipedia.org/wiki/Child_abductions_in_the_Russo-Ukrainian_War

6,318 posted on 05/05/2024 8:13:22 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6317 | View Replies]

Mothers in hospitals in temporarily occupied Luhansk region are facing threats of having their newborns taken away unless either parent has Russian citizenship. According to ISW, these actions violate Article II(d) of the Genocide Convention.

https://twitter.com/United24media/status/1786741268313207028


6,319 posted on 05/05/2024 8:19:23 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6318 | View Replies]

Russian disruption in Europe points to patterns of future aggression
The case of Britons allegedly working for Russian intelligence is just one example of how Moscow is actively disrupting normal life in Europe and the Baltic region.
https://www.chathamhouse.org/2024/05/russian-disruption-europe-points-patterns-future-aggression


6,320 posted on 05/05/2024 9:18:25 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6319 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 6,281-6,3006,301-6,3206,321-6,340 ... 6,941-6,956 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson