Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

Russian military convoy has advanced from Ivankiv to outskirts of Kyiv, satellite images show (17 miles long)
CNN ^ | February 28th, 2022 | Paul P. Murphy

Posted on 02/28/2022 8:10:18 PM PST by Mariner

A Russian military convoy that was outside of Ivankiv, Ukraine, on Sunday has since made it to the outskirts of Kyiv, satellite images show.

On Sunday, the convoy was roughly 40 miles northwest of the Ukrainian capital, according to images provided by Maxar Technologies.

Maxar said that roughly 17 miles of roadway is chocked full of the convoy, which consists of armored vehicles, tanks, towed artillery and other logistical vehicles.

The private US company said the convoy was located on the T-1011 highway at Antonov air base around 11:11 a.m local time.

Antonov is roughly 17 miles from the center of the Ukrainian capital.

(Excerpt) Read more at cnn.com ...


TOPICS: Foreign Affairs; News/Current Events; Russia
KEYWORDS: accordingtoplan; aholesandoligarchs; alexanderlukashenko; asplanned; belarus; bidensfolly; chechens; chechnya; coldwarjunkies; deadrussianhomos; deadrussians; deathtochechnya; deathtoputin; deathtorussia; eurowankers; genius; ghostofkiev; globohomo; holodomor; isaidbudlight; lakhtabot; lukashenko; maxartechnologies; militarygenius; moldova; momoneymomoney; moskva; mumsiemaximus; natosfailing; newworldorder; nyuknyuknyuk; odesa; odessa; pedosforputin; poordoomedwangers; putin; putinlovertrollsonfr; putinsbuttboys; putinthehomo; putinworshippers; ramzankadyrov; russia; russianaggression; russianatrocities; russianhomos; russiansuicide; russianwarcrimes; russianwarcriminals; scottritter; sergeyshoigu; siloviki; smartandsavvy; theholodomor; tombofbakhmut; tothelastukie; transnistria; trostyanets; trustzelsplan; ukenazistoast; ukraine; vladimirsolovyov; vladtheimploder; vlodtheimpaled; wagnergroup; warinukraine; warpigs; wgafdamant; whiteflagofazov; yevgenyprigozhin; yousankmybattleship; zeeperfap; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovevindman; zelenskyy; zottherussiantrolls
Navigation: use the links below to view more comments.
first previous 1-20 ... 4,581-4,6004,601-4,6204,621-4,640 ... 6,521 next last
To: AdmSmith

Girkin/Strelkov (after 4 h sleep):

Well, early in the morning Prigogine took Rostov. The headquarters of the Southern Military District and the Internal Affairs Directorate for the Rostov Region (and probably the UFSB) are under his control. Negotiates with Yevkurov and Alekseev. Threatens to go to Moscow. He boasts of three downed helicopters of the RF Armed Forces and promises to shoot down more. He won his first major success. Now, either a civil war right now or... a little later...
https://t.me/strelkovii/5645


4,601 posted on 06/23/2023 10:10:02 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 4600 | View Replies]

To: AdmSmith
“Liberty of Russia” Legion @legion_svoboda
⚡️⚡️ Caesar's address on the Prigozhin situation.

I have the honor!

Interesting events are unfolding in the expanses of our homeland and they are very reminiscent of the troubled times of a century ago. The stupid, corrupt and incompetent military-political top of Putin's Russia turns hundreds of thousands of men into mincemeat.

Evgeny Prigozhin, himself a descendant of Putin's nomenklatura, has decided that it is time for him to play his own game, thanks to his “orchestra” at the ready. We know that he has many supporters among the Russian population and within the security services. We know that Prigozhin has big political ambitions and that he is fed up with greasy generals in offices who can't really fight. We know that if he launches an armed insurgency, he is very likely to succeed. But we also remember how he and his accomplices cut people's heads off, killed their own people with a hammer cynically videotaped and mocked the unarmed. We should not ascribe to him a military honor and valor that does not exist.

Prigozhin calls for a fight against the renegade generals and for a war to the bitter end. But this war is not in the interests of the peoples of Russia. Prigozhin’s battle with Shoigu, Gerasimov, and their generals is simply a battle for a feeding trough and the opportunity to continue to destroy and plunder the nations. Today's Russia is a collection of jackals who are tearing each other and the entire country apart.

We, the free citizens of Russia, will not leave our people alone with uncertainty and fear. We will put an end to the war and free our homeland from the rotten system, no matter whose system it is: Putin's or Prizhin’s.

Our comrades-in-arms, get ready! Russia will be free!

https://twitter.com/legion_svoboda/status/1672348371938320392

Liberty of Russia” Legion raided into Russia earlier:
https://freerepublic.com/focus/f-news/4042550/posts?page=4421#4421

4,602 posted on 06/23/2023 10:21:51 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 4600 | View Replies]

To: AdmSmith

According to the source, the main actions of the “Prigozhin rebellion” will unfold in Rostov, where the headquarters of the Southern District and the operational headquarters of the Northern Military District are located. Events are unlikely to touch Moscow; Prigozhin’s asset in the capital is loose. But the authorities are rather afraid of unauthorized support actions.
PMC frankly wants to establish control over the Rostov and Voronezh regions.
Another source noted that Prigozhin’s significant media machine has not yet been launched, the authorities are urgently trying to create problems for it and block Prigozhin’s calls.
The military expert believes that it will not be possible to suppress Prigozhin’s rebellion on the front line - “if the army takes care of Prigozhin, then the Armed Forces of Ukraine will take care of the army.”
The situation is still stalemate. The Kremlin cannot rigorously clean up the Cheka in Rostov without mass casualties, but it cannot allow the existence of a rebellion either.

https://t.me/rusbrief/129134


4,603 posted on 06/23/2023 10:54:45 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 4602 | View Replies]

To: AdmSmith

So far, most official sources characterize the situation as a personal conflict between Prigozhin and Shoigu. And they say that the Kremlin failed to resolve the conflict. Part of the command of the Armed Forces does not want to turn the conflict into combat clashes and persuade the parties to resolve the issue peacefully. At the same time, the statement of the FSB Investigation Department shocked many people. How to get out of the situation is not clear. Who should leave is not clear. Will there be blood - this is the most negative scenario that can open Pandora’s box and break the structure of power.

https://t.me/rusbrief/129222


4,604 posted on 06/23/2023 11:07:42 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 4603 | View Replies]

To: AdmSmith

Yevgeny Prigozhin in Rostov:
“We lost huge amount of territories in Ukraine. The Russian losses in Ukraine are 3-4 times higher than reported by the Russian High Command. Up to 1000 casualties a day (KIA + WIA).”

https://twitter.com/Tendar/status/1672468948141391874


4,605 posted on 06/23/2023 11:14:47 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 4604 | View Replies]

To: AdmSmith

The Ministry of Defense of the #Russian Federation turned to the Wagnerites:

“You were deceived into #Prigozhin’s criminal adventure and participation in an armed rebellion.
Many of your comrades from several squads have already realized their mistake in asking for help in ensuring the ability to safely return to their places of permanent deployment. Such assistance from our side has already been provided to all the fighters and commanders who applied.
We ask you to be prudent and get in touch with representatives of the Russian Ministry of Defense or law enforcement agencies as soon as possible.
We guarantee everyone’s safety.”

https://twitter.com/nexta_tv/status/1672487517700997120


4,606 posted on 06/23/2023 11:21:28 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 4605 | View Replies]

To: AdmSmith

Russian Offensive Campaign Assessment, June 23, 2023 (timestamp June 23, 2023, 8:45pm ET)

Wagner Group financier Yevgeny Prigozhin appears to have launched an armed rebellion on June 23 to force a leadership change within the Russian Ministry of Defense (MoD) which is unlikely to succeed.
Early reports following Prigozhin’s statements suggest that Russian internal security forces are activating in response to Prigozhin’s statements and possible Wagner moves, primarily in Moscow and Rostov, and the Kremlin appears opposed to Prigozhin’s actions.
Prigozhin set informational conditions for this effort earlier in the day by accusing the Russian MoD and unnamed oligarchs of deceiving Putin and the Russian public in order to launch the 2022 Russian invasion of Ukraine.
Prigozhin likely intends to truly conduct an armed rebellion against the Russian MoD, rather than expecting Kremlin support to compel MoD leadership changes or only escalating rhetorically.
It is therefore most likely that Prigozhin fully intends for Wagner to move against MoD leadership and forcibly remove them from power, more likely against the Southern Military District command in Rostov-on-Don but possibly also against Moscow.
An armed Wagner attack against the Russian military leadership in Rostov-on-Don would have significant impacts on Russia’s war effort in Ukraine.
Prigozhin’s apparent start of an armed rebellion is the culmination of his campaign to retain control over his military forces, and he likely views the rebellion as an existential survival effort.
Prigozhin’s likely intention was to gain the allegiance of senior Russian officers and military personnel, but he is unlikely to secure sufficient military support considering that Wagner-affiliated Army General Sergei Surovikin denounced Prigozhin’s call for armed rebellion.
Even if the Wagner Group can credibly threaten the MoD, Putin is incredibly unlikely to acquiesce to a successful effort by Prigozhin to topple the MoD.
Ukrainian forces conducted counteroffensive operations on at least two sectors of the front on June 23.
Russian forces conducted another series of missile and drone strikes against Ukraine on June 23, primarily targeting a Ukrainian airfield in Khmelnytskyi Oblast.
Russian forces continued to conduct limited ground attacks in the Kupyansk area, and Russian and Ukrainian forces continued to skirmish south of Kreminna.
Russian forces did not conduct any confirmed ground attacks in the Bakhmut area.
Russian and Ukrainian forces continued limited offensive operations along the Avdiivka-Donetsk City front.
Russian and Ukrainian forces continued ground attacks in the western Donetsk-eastern Zaporizhia Oblast border area.
Ukrainian forces continued counteroffensive operations in western Zaporizhia Oblast.
Russian federal subjects and the Wagner Group continue efforts to conceal the true scale of Russian and Wagner losses in Ukraine.
Ukrainian officials reported that Russian and occupation administrations continue to disregard the lives of Ukrainian civilians in occupied territories.

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-june-23-2023


4,607 posted on 06/23/2023 11:25:53 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 4565 | View Replies]

To: AdmSmith
Reporting from Ukraine 23 Jun: RUSSIANS KILL EACH OTHER IN A SUDDEN VIOLENT COUP | Day 485:

Today there was an insane sequence of events that ended up with the Head of the biggest Russians private military company, the Wagner Group, Prigozhin, starting a coup on the territory of the Russian Federation and declaring that his goal is to remove the Russian Defense Minister, Shoigu, and the Chief of the General Staff, Gerasimov, and that anyone who stands in his way will be destroyed.

https://www.youtube.com/watch?v=fmITp1Kz1yU 5 min

4,608 posted on 06/23/2023 11:33:23 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 4606 | View Replies]

To: AdmSmith

It took the law enforcement agencies 7 (!) hours to begin searches in the offices of Yevgeny Prigozhin. During this time, you can even remove the furniture.

https://t.me/rusbrief/129315


4,609 posted on 06/23/2023 11:39:58 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 4608 | View Replies]

To: AdmSmith
Lukashenko’s plane landed in Turkey moments ago

https://twitter.com/canlarfikretler/status/1672490605975420928

Lot of rumors

4,610 posted on 06/23/2023 11:46:37 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 4609 | View Replies]

To: AdmSmith
SVR General 24JUN2023:

After a SERIES of unsuccessful attempts to implement the order of Russian President Vladimir Putin to finally “resolve the issue” with PMC Wagner and personally with Yevgeny Prigozhin, the head of the PMC openly called for a rebellion, demanding reprisals against Defense Minister Sergei Shoigu and Chief of the General Staff Valery Gerasimov.

The President is indeed regularly reported on what is happening, BUT! Since yesterday evening, despite persuasion and even “urgent requests” from the leadership of the power bloc, the president has NOT MADE A SINGLE DECISION! The leadership behind the power bloc, headed by Secretary of the Security Council of the Russian Federation Nikolai Patrushev, believes that Prigozhin’s rebellion should be severely suppressed. Putin was given several options for the forceful neutralization of the rebels, but he refused to even discuss these options.

The president has practically withdrawn himself from solving the current crisis. Part of the orders on behalf of the president is given by Nikolai Patrushev, he also controls and coordinates the actions of the security forces and partly the leadership of the military bloc. At night, from several influential people from the president's entourage, Patrushev received an offer to take full control over the government of the country into his own hands, but SOMEWHERE the Secretary of the Security Council refused the offer. Shoigu and Gerasimov are in contact with Patrushev and received verbal support from him. Patrushev during the meeting said that he considers the scenario of the seizure of power in Russia by Prigozhin impossible, according to the Secretary of the Security Council, the leadership of the PMC Wagner does not have the strength and means for this. After the report on the capture of Rostov under the control of PMC Wagner, Putin went to bed.

https://t.me/generalsvr/1660

4,611 posted on 06/23/2023 11:57:26 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 4576 | View Replies]

To: AdmSmith

MIG of Russia
⚡️Putin’s address has already been recorded and is being prepared for broadcast

https://t.me/mig41/27064


4,612 posted on 06/23/2023 11:59:55 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 4610 | View Replies]

To: AdmSmith
President Putin has spoken for the first time since the Wagner mercenary group vowed to topple Russia's military leadership.

We'll bring you analysis of what he said shortly, but for now, here's a video of a section of Putin's speech, with voiceover translation.

In his address to the nation, he urged the consolidation of all forces and said what was happening was “a betrayal” and “a knife in the back of our people”.

Putin also stresses that all “necessary orders have been given” to deal with the crisis, pledging to defend Russia.

And that's the end of his short TV address - he did not mention Prigozhin once.

He did mention Wagner mercenaries, but only to praise them for fighting for Russia.
https://www.bbc.com/news/live/world-europe-66006142

This was recorded x h ago, and they have to keep all options open...

4,613 posted on 06/24/2023 12:34:37 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 4612 | View Replies]

To: AdmSmith

256 km2 at Rostov-on-Don controlled by rebels [=Wagner]

https://deepstatemap.live/en#8/46.993/37.491


4,614 posted on 06/24/2023 12:42:34 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 4613 | View Replies]

To: adorno; alexander_busek; AmericanInTokyo; ArtDodger; AZJeep; baclava; BeauBo; Berlin_Freeper; ...

4,615 posted on 06/24/2023 12:50:17 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 4564 | View Replies]

To: AdmSmith
Georgy Fedorov:

Putin spoke. It is clear that he will not succumb to blackmail. He gave the order to put down the rebellion. The logic is clear. Now the question is how deep is the conspiracy. Will the secret services and bodies resist the rebellion. So far, Prigogine has the initiative. His next step is the announcement of the beginning of the revolution and the change of Putin. Further, as I said above. Once again, I am sure that the coup was not just being prepared, but is going according to plan. The next two days are decisive. They will try to capture Moscow and establish control over it. Otherwise, the rebellion made no sense. The stakes are huge. This is a February attempt.

https://t.me/georgy_fedorov/1897

4,616 posted on 06/24/2023 12:54:14 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 4615 | View Replies]

To: AdmSmith
Full morning of 24 June address by Putin to the nation in regards to the military coup:

“I appeal to the citizens of Russia, to the personnel of the Armed Forces, law enforcement and security services, fighters and commanders currently fighting on their positions, repelling the enemy attacks, doing it heroically.

I spoke to the commanders in all directions last night. I appeal also to those who were deceptively pulled into the criminal adventure, pushed towards a serious crime of an armed mutiny.

Russia today is leading the most difficult war for its future, repelling the aggression of neo-nazis and their handlers. Against us, the whole military, economical and information machines of the West are turned.

We fight for the lives and security of our people. For our sovereignty and independence. The right to remain Russia, a state with 1000 years of history.

It's a battle where the fate of our people is decided requires uniting of all our forces, unity, consolidation and responsibility. Everything else hat weakens us must be shoved to the side.

Our external enemies are using any arguments to undermine us from within. Thus, actions splitting our unity is a betrayal of our people, our combat brothers who fight now at the frontline. It's a strike in the back of our country and our people.

Exactly this strike was dealt in 1917 when the country was in WW1, but its victory was stolen. Intrigues, and arguments behind the army's back turned out to be the greatest catastrophe, destruction of the army and the state, loss of huge territories, resulting in a tragedy and a civil war.

Russians were killing Russians, brothers killing brothers. But the beneficiaries were various political chevaliers of fortune and foreign powers who divided the country, and tore it into parts. We will not let this happen.

We will protect our people and state from any threats, including internal betrayal. What we're facing is exactly internal betrayal. Extraordinary ambitions and personal interests led to treason. Treason of their own country and people and of the case that fighters of Wagner were dying for alongside our soldiers.

Heroes who liberated Soledar and Artemivsk, towns and cities of the Donbas. They fought and were giving lives to Novorossiya and the unity of the Russian world. Their name and glory were also betrayed by those who are trying to organise the mutiny, pushing the country into anarchy and brother-killing, to a defeat, in the end, and capitulation.

Repeat: any internal mutiny is a deadly threat to our state, to us as a nation. It's a strike against our nation, our people. And our actions to defend the fatherland from such a threat will be brutal.

Anyone who consciously went on the path of betrayal, who prepared the armed mutiny, went on the path of blackmail and terrorist actions, will take an inevitable punishment.

They will answer to the law and our people. The Armed Forces and other departments were properly instructed. Extra anti-terrorist measures are now being implemented in Moscow, Moscow region, and a number of other regions.

Decisive actions will be taken to stabilise the situation in Rostov-on-Don. It remains difficult. The operation of civilian and military control departments is practically blocked.

As a President of Russia and the Supreme Commander, as a citizen of Russia, I will do everything to defend the country, protect the Constitution, lives and safety, liberty of the citizens.

Those who prepared the military mutiny, who raise weapons against combat brothers, have betrayed Russia, and will pay for this. And those who are being pulled into the crime, I'm asking to not make this crucial, tragic, unrepeatable mistake. Do the one right choice - stop participating in criminal actions.

I believe that we will defend and preserve what's sacred for us. And together with the motherland, we will overcome all challenges, and become even stronger.

https://twitter.com/wartranslated/status/1672508593969549312

4,617 posted on 06/24/2023 12:57:35 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 4613 | View Replies]

To: AdmSmith
19JUN2023:
Vladimir Putin has ordered the Russian Ministry of Defence to replace the Yevgeny Prigozhin’s Wagner Group convict troops with the Kremlin's own Storm-Z punitive battalions and Chechen special forces. The surviving prisoners from the so-called Storm-Z companies are reportedly being transferred by Russia to strengthen their Volunteer Corps, according to Ukrainian military intelligence.

https://www.express.co.uk/news/world/1782125/Putin-Wagner-Storm-Z-Ukraine

BUT today:
Men who say they are convicts from Storm Z penal units are supporting Prigozhin.

https://twitter.com/wartranslated/status/1672514994108235778

What could possibly go wrong?

4,618 posted on 06/24/2023 1:06:45 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 4617 | View Replies]

To: AdmSmith

Darth Putin @DarthPutinKGB
I’m beginning to think that giving a psychopath his own private army of criminals was not a good idea.
https://twitter.com/DarthPutinKGB/status/1672352361161924608


4,619 posted on 06/24/2023 1:10:21 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 4618 | View Replies]

Wagner took 9 months to capture Bakhmut and 3 hours to capture Rostov.
https://twitter.com/DarthPutinKGB/status/1672514271438053376


4,620 posted on 06/24/2023 1:11:14 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 4619 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 4,581-4,6004,601-4,6204,621-4,640 ... 6,521 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson