Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

Intelligence genes discovered by scientists
Photo: AP The Telegraph ^ | 21 Dec 15 | Sarah Knapton

Posted on 12/22/2015 4:43:59 AM PST by SkyPilot

Imperial College London has found that two networks of genes determine whether people are intelligent or not so bright.

Genes which make people intelligent have been discovered and scientists believe they could be manipulated to boost brain power.

Researchers have believed for some time that intellect is inherited with studies suggesting that up to 75 per cent of IQ is genetic, and the rest down to environmental factors such as schooling and friendship groups.

But until now, nobody has been able to pin-point exactly which genes are responsible for better memory, attention, processing speed or reasoning skills. Now Imperial College London has found that two networks of genes determine whether people are intelligent or not-so-bright.

They liken the gene network to a football team. When all the players are in the right positions, the brain appears to function optimally, leading to clarity of thought and what we think of as quickness or cleverness.

However when the genes are mutated or in the wrong order, it can lead to dullness of thinking, or even serious cognitive impairments.

Scientists believe that there must be a 'master switch' regulating the networks and if they could find it, they could 'switch on' intelligence for everyone.

"We know that genetics plays a major role in intelligence but until now haven’t known which genes are relevant," said Dr Michael Johnson, lead author of the study from the Department of Medicine at Imperial College.

"This research highlights some of genes involved in human intelligence, and how they interact with each other."

(Excerpt) Read more at telegraph.co.uk ...


TOPICS: Culture/Society; Extended News; Front Page News; Government; News/Current Events; War on Terror
KEYWORDS: catastrophism; genes; godsgravesglyphs; helixmakemineadouble; intelligence; iq; race; stringtheory; xplanets
Navigation: use the links below to view more comments.
first previous 1-2021-4041-6061-8081-94 next last
To: libertylover; SkyPilot; SunkenCiv; All

You don’t even have to go to different races. Just look at men and women. Who is the finder in most homes, the woman. “Honey, where are my socks?” “Under the bed where you always leave them.” Men tend to deal better in abstractions. Hunting for moving game has favored those kind of genes for millions of years. In addition hunting tends to be a silent activity, not conversational like food gathering. Women honed their skills for remembering information like where are the best fruits, nuts and roots, and when will they be ready to pick. When traveling, will a man ask someone how to find a place, no, he will drive around hoping to find it like a wild animal. A woman will ask any reasonable person, because of lots of generations hanging with other people, mostly women and children and sharing information.


61 posted on 12/24/2015 12:37:23 AM PST by gleeaikin
[ Post Reply | Private Reply | To 24 | View Replies]

To: libertylover; SkyPilot; SunkenCiv; All

You don’t even have to go to different races. Just look at men and women. Who is the finder in most homes, the woman. “Honey, where are my socks?” “Under the bed where you always leave them.” Men tend to deal better in abstractions. Hunting for moving game has favored those kind of genes for millions of years. In addition hunting tends to be a silent activity, not conversational like food gathering. Women honed their skills for remembering information like where are the best fruits, nuts and roots, and when will they be ready to pick. When traveling, will a man ask someone how to find a place, no, he will drive around hoping to find it like a wild animal. A woman will ask any reasonable person, because of lots of generations hanging with other people, mostly women and children and sharing information.


62 posted on 12/24/2015 12:42:57 AM PST by gleeaikin
[ Post Reply | Private Reply | To 24 | View Replies]

To: metmom; i_robot73; SunkenCiv; All

“Pretty much gone are the days of building trades, auto mechanics, and other trades.”

How I wished that there were such courses in the Urban schools my dyslexic son attended. He might not have dropped out. I taught him some things because I was renovating a property. Eventually he got a job as an electrical helper, and now has his own small property maintenance and repair business. We complain about cheap immigrant labor, often illegal, but we make sure our own people don’t get a chance to learn the skills. I guess big business would much rather have cheap foreign labor than encourage their own citizens, since they often buy the politicians who maintain the status quo.


63 posted on 12/24/2015 12:48:11 AM PST by gleeaikin
[ Post Reply | Private Reply | To 38 | View Replies]

To: BroJoeK; SkyPilot; wrench; bert; metmom; IronJack; Smokin' Joe; SunkenCiv; libertylover; All

Your last two paragraphs seem illogical. You say that as the Democrats aid lower classes and immigrants the result is that they become Republicans as they seek more uplifting ideas. Then you draw the strange conclusion that they are bombarding us with HIGH quality new immigrants and their purpose is to have them as future Democrat voters, and that without them the D party would fade away.


64 posted on 12/24/2015 12:58:41 AM PST by gleeaikin
[ Post Reply | Private Reply | To 51 | View Replies]

To: SkyPilot

I think a lot about intelligence like this. First, I don’t think it brings anything to humans to categorize us in IQ hierarchies by race. Race is a stupid concept, and though there are some medical reasons to differentiate, I say, screw them, and let’s do away with the entire concept.

Back to IQ. My family has fairly high scores, and I’ve enjoyed raising some bright and very bright kids. But I have a special needs kid who doesn’t fall anywhere near them on that scale, and he is wonderful too. I am grateful to have learnt in the last 10 years how important we all are. How we need all kinds on this earth. How there are many kinds of jobs to do: human jobs as well as earning a living jobs, and how there are jobs for all sorts of people.

And that clarity of thought that high IQ gives you? Well, it’s limited too, perhaps. Both my parents were so smart, in different ways from each other, and both have been reduced to helplessness by Alzheimer’s. Hold intelligence as valuable but it’s not everything.


65 posted on 12/24/2015 1:15:41 AM PST by Yaelle (Since PC is not actually "correct," it should be renamed Political Pandering.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: gleeaikin
gleeaikin: "Then you draw the strange conclusion that they are bombarding us with HIGH quality new immigrants and their purpose is to have them as future Democrat voters, and that without them the D party would fade away."

Sorry for any confusion, I'll confess that sentence is less readable than it should be.
But if you look again, you'll see that I intended: "not just high quality new immigrants, but [also, and] more to Democrat purposes: the worst of the worst, [to be] future Democrat voters."

Is that better?

Here's my point: records show that since IQ'S were first tested (Stanford-Binet, 1916) average scores have slowly increased amongst all groups.
It's called the "Flynn effect" and is especially pronounced among new immigrant groups, second & third generations, etc.

So I merely observed (only half facetiously) that as their IQs increase, people figure out that Democrat Big Government nostrums are really intended to benefit only Big Government, and to keep everyone else in a state of dependence.
Such people begin looking for political solutions which do not require ever more taxes, regulations & control, etc. and thus can finally become persuadable to more conservative ideas.

So, as the second, third & fourth generations of immigrants begin to move up, and become more conservative, Democrats have to fill in their ranks with ever more new immigrants, and the less likely those immigrants are to move up, the better for Dems.

Does that seem logical to you now?

66 posted on 12/24/2015 5:14:26 AM PST by BroJoeK (a little historical perspective...)
[ Post Reply | Private Reply | To 64 | View Replies]

To: libertylover
libertylover: "I still wonder though, since if you compare say, blacks to whites, blacks have or tend to have different noses, different lips, different hair, etc. so it seems possible, perhaps probable, that their brains work a little differently too."

First of all, you need to grasp the fact that DNA studies show far more variations among various African populations than between any two non-African populations.
IOW, Europeans are more closely related to Asians than either is to Africans, and many Africans are more distantly related to other Africans than they are to Euro-Asians.
Point is: you can't say, "Africans this, or Africans that", any more than you would lump together Europeans & Asians.

Second, most African-Americans are of mixed Afro-European ancestry, somewhat similar to, for example, Egyptians.

Third, African-Americans score higher on IQ tests than any others of African descent in the world, and those scores continue to rise anywhere they are not destroyed by cultural pathologies like drug abuse, single parent families, anti-"white" attitudes, etc..

Finally, think of human brains the same way we think of computers: there's hardware (DNA design) and software (culture) each effecting the other profoundly.
But unlike computers, no two humans have exactly the same mix of hardware & software, and especially diverse groups such as African-Americans will necessarily be more diverse amongst themselves than are, for example, different European populations.

Does that make sense?

67 posted on 12/24/2015 5:35:17 AM PST by BroJoeK (a little historical perspective...)
[ Post Reply | Private Reply | To 58 | View Replies]

To: SkyPilot

Let us be thankful for the fools. But for them the rest of us could not succeed.


68 posted on 12/24/2015 7:05:40 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 30 | View Replies]

To: BroJoeK
I believe it is why the Democrats/Socialists/Communists hijacked the education system: to reduce not just history, but logic itself to mindlessly disconnected dribs and drabs of actual events colored by endless citations and re-hashes of victimhood.

How few know the triumphs of Booker T. Washington or George Washington Carver, but almost all know the travails of Rosa Parks.

Regardless of IQ, keeping the victimhood myth alive is a useful tool, based on kernels of truth but embellished and continually stroked to produce an entire class of people who certainly could have improved their lot had they not been convinced they deserved handouts and freebies on the backs of people who never oppressed them.

In keeping with international socialist dogma, those being imported illegally are similarly convinced they have a "right" to what they did not build, in spite of our laws.

The Democrat Party was hijacked by Socialists and Communists pretty thoroughly by the end of the Vietnam War, and the people they are importing from elsewhere have either a pretty thorough indoctrination from their native banana republic, or are Muslim tools being used to cause the sort of chaos and mayhem the totalitarians desperately need in order to complete their seizure of power.

69 posted on 12/24/2015 10:31:35 AM PST by Smokin' Joe (How often God must weep at humans' folly. Stand fast. God knows what He is doing.)
[ Post Reply | Private Reply | To 51 | View Replies]

To: Smokin' Joe

Amen, bro.


70 posted on 12/24/2015 6:47:42 PM PST by BroJoeK (a little historical perspective...)
[ Post Reply | Private Reply | To 69 | View Replies]

To: BroJoeK; All

Basically my problem was that I interpreted “worst of the worst” as referring to future Democrats rather than back to the previously mentioned “HIGH quality new immigrants.”


71 posted on 12/24/2015 9:42:02 PM PST by gleeaikin
[ Post Reply | Private Reply | To 66 | View Replies]

To: SkyPilot

I probably lean towards the not so bright.


72 posted on 12/24/2015 10:38:10 PM PST by wastedyears (uchikudake - toki michite - ikiru tame - tokihanate)
[ Post Reply | Private Reply | To 1 | View Replies]

To: gleeaikin
gleeaikin: "Basically my problem was that I interpreted “worst of the worst” as referring to..."

Not your fault, my apologies, thanks for your response.

73 posted on 12/25/2015 6:17:31 AM PST by BroJoeK (a little historical perspective...)
[ Post Reply | Private Reply | To 71 | View Replies]

To: SkyPilot

Sky... that picture of Albert...

The man had some SERIOUS MENSCH HAIR!!!!!!!!!
The “flow” was strong with that one...!!

Awesome pic.


74 posted on 12/25/2015 8:28:04 AM PST by NFHale (The Second Amendment - By Any Means Necessary.)
[ Post Reply | Private Reply | To 2 | View Replies]

To: SkyPilot
Some of us are given incredible beauty, some are given athletic ability, some are given musical talent, some are given higher intellect.

If you're like me, you get ALL of that! I've also been gifted with profound humility.

75 posted on 12/25/2015 9:42:12 AM PST by Greetings_Puny_Humans (I mostly come out at night... mostly.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Greetings_Puny_Humans

Some of us are given incredible beauty, some are given athletic ability, some are given musical talent, some are given higher intellect.

If you're like me, you get ALL of that! I've also been gifted with profound humility. Are we related? Finding IQ genes is loads easier than finding, say, correlation between weather and CO2 levels. But, yeah, I was blessed with a highly intelligent dad and granddad, and a nurturing mom. Also smart smart brothers.

76 posted on 12/25/2015 10:52:02 AM PST by bIlluminati (Who is Horatio Bunce?)
[ Post Reply | Private Reply | To 75 | View Replies]

To: SkyPilot

That wild haired guy in the photo must be an idiot. Doesn’t he know smoking is baaaaaaaaad for you?

/sarc


77 posted on 12/25/2015 11:22:34 AM PST by fishtank (The denial of original sin is the root of liberalism.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: metmom

Yes, practical use is what is important coupled with integrity, honesty and character so that the raw intelligence can be used for good.


78 posted on 12/25/2015 12:22:41 PM PST by rotundusmaximus (1Kings19:18 Yet I have left me seven thousand in Israel, all the knees which have not bowed unto Baa)
[ Post Reply | Private Reply | To 12 | View Replies]

To: metmom

Yes, practical use is what is important coupled with integrity, honesty and character so that the raw intelligence can be used for good.


79 posted on 12/25/2015 12:36:01 PM PST by rotundusmaximus (1Kings19:18 Yet I have left me seven thousand in Israel, all the knees which have not bowed unto Baa)
[ Post Reply | Private Reply | To 12 | View Replies]

To: metmom

Yes, practical use is what is important coupled with integrity, honesty and character so that the raw intelligence can be used for good.


80 posted on 12/25/2015 12:36:07 PM PST by rotundusmaximus (1Kings19:18 Yet I have left me seven thousand in Israel, all the knees which have not bowed unto Baa)
[ Post Reply | Private Reply | To 12 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-2021-4041-6061-8081-94 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson