Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

How Islamic Are Islamic Terrorists?
National Catholic Register ^ | 11/20/2015 | EDWARD PENTIN

Posted on 11/21/2015 1:06:34 AM PST by GonzoII

According to experts, the fundamentalist jihadists who carry out murderous attacks are Muslims whose beliefs are rooted partly in longstanding Islamic teachings.

ROME - President Barack Obama refrained from describing Nov. 13's Paris attacks as "Islamic terrorism" or even radical Islamic terrorism, continuing his policy of distancing such atrocities from the religion.

But that nonetheless leaves open the question: How Islamic are Islamic terrorists?

To equate the attacks with "views of Islam" creates "stereotypes" that are "counterproductive" and "wrong," Obama told reporters at the G20 Summit in Antalya, Turkey, Nov. 16. "They will lead, I think, to greater recruitment into terrorist organizations over time, if this becomes somehow defined as a Muslim problem as opposed to a terrorist problem."

The Nov. 13 coordinated terrorist attacks of mass shootings, suicide bombings and hostage-taking were the deadliest in France since World War II, costing 129 lives and leaving at least 80 critically injured. The Islamic State group (ISIS), a fundamentalist jihadist group that emerged from the Sunni vs. Shiite conflicts in Iraq and Syria, claimed responsibility for the atrocity. Following the attacks, eight of the attackers were dead - seven of them from suicide explosions and one killed by security forces in the music venue.

President Obama, like President George W. Bush before him, has long been reluctant to tie a "true Islam" to such attacks. Many Muslims also try to distance themselves from any linkage of their religion to violence, asserting that such claims are false and expose "moderate Muslims" to potential reprisals or victimization.


(Excerpt) Read more at ncregister.com ...


TOPICS: Culture/Society; Editorial
KEYWORDS: daesh; iraq; isis; islam; jihad; rop; shiite; sunni; syria; terrorism; wahhabism
Navigation: use the links below to view more comments.
first previous 1-2021-4041-45 next last
To: x_plus_one
Mohammed and Charlemagne

Everyone who wonders about Islam should read it.

the book

21 posted on 11/21/2015 3:01:51 AM PST by arthurus (Het is waar. Tutti i liberali sono feccia.)
[ Post Reply | Private Reply | To 7 | View Replies]

To: fieldmarshaldj

ISIS has become the shock troops for the Islamic ideology, much like the Waffen-SS were the shock troops for National Socialist German Workingmen’s Party of Germany, during the Second World War.

Ruthless brutality, scorched earth policy of areas of conquest, and fanatical determination in the face of certain death, even the Japanese kamikaze suicide pilots that were the scourge of the US Pacific fleet in the last part of that war, were not more damaging to the perceived enemy, the whole of Western civilization, than the bearded men with the burning eyes, who live beyond the realm of reason.

Excess for the sheer unholy glee at pursuing excess. For the apologists for the Worldwide Caliphate, the thrill of watching the deathmatch struggle of ISIS remains the major attraction for their support.

A cancer upon the human race. These enthusiasts of doom and destruction are cheering FOR the malign tumor that is Islam, and is growing in the world. If the objective is decimation of the entire human race, this seems a rather inefficient way of attaining it. The Second World War, with its emphasis on the widespread annihilation of the civilian population, succeeded in only a very small way in reducing the overall human population of the planet, and that for only a very short period.

Now that we need you to contain the Muslim explosion upon the world, Genghis Khan, where are you?


22 posted on 11/21/2015 3:05:47 AM PST by alloysteel (Do not argue with trolls. That means they win.)
[ Post Reply | Private Reply | To 3 | View Replies]

To: TigersEye

Mohammed was a terrorist. Wasn’t he Islamic?

You spelled pedophile wrong.


23 posted on 11/21/2015 3:06:35 AM PST by GeneralisimoFranciscoFranco (I love liberals. They taste like chicken.)
[ Post Reply | Private Reply | To 2 | View Replies]

To: GonzoII

The head of ISIS has a PhD in Islamic Studies from the Islamic University in Baghdad.


24 posted on 11/21/2015 3:44:38 AM PST by FreedomPoster (Islam delenda est)
[ Post Reply | Private Reply | To 1 | View Replies]

To: GonzoII
HERE'S your answer
25 posted on 11/21/2015 3:47:33 AM PST by knarf (I say things that are true .... I have no proof ... but they're true.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: knarf
"HERE'S your answer"

Bump!

26 posted on 11/21/2015 4:10:33 AM PST by GonzoII ("If the new crime be, to believe in God, let us all be criminals" -Sheen)
[ Post Reply | Private Reply | To 25 | View Replies]

To: fieldmarshaldj; goldstategop; x_plus_one; Gene Eric; dp0622; GraceG; Slings and Arrows; livius; ...
Mohammed and Charlemagne

Epilogue

27 posted on 11/21/2015 4:34:19 AM PST by arthurus (Het is waar. Tutti i liberali sono feccia.)
[ Post Reply | Private Reply | To 3 | View Replies]

To: goldstategop
I read a fascinating comment from King Hussein of Jordan, who described Middle Eastern democracy as a bus ride.

I'm paraphrasing this, but he said: "Once the bus gets to their stop, they just get off ... and the bus doesn't mean anything to them anymore."

28 posted on 11/21/2015 4:38:42 AM PST by Alberta's Child ("It doesn't work for me. I gotta have more cowbell!")
[ Post Reply | Private Reply | To 5 | View Replies]

To: alloysteel
While we're at it, let's put ISIS in its proper Western perspective, too.

The attacks in Paris on one day last week involved fewer deaths than the average daily carnage in abortion clinics right here in the U.S.

There's a reason why radical Islam will ultimately win this battle. Only one side is taking casualties, and most of those casualties are self-inflicted.

29 posted on 11/21/2015 4:41:44 AM PST by Alberta's Child ("It doesn't work for me. I gotta have more cowbell!")
[ Post Reply | Private Reply | To 22 | View Replies]

To: GonzoII

Obama gave Osama Bin Laden a respectful Islamic funeral (at taxpayer expense) so as not to p!ss off Islamic terrorists.

Now why is that if Osama and the other terrorists aren’t really Islamic?


30 posted on 11/21/2015 4:44:34 AM PST by a fool in paradise (The goal of Socialism is Communism. Marx and Lenin were in agreement on this.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: goldstategop

Islam is an all encompassing political system. It is not open to democracy. It is exclusionary theocratic. If you want to see segregation in the world today, look at the Islamist countries.


31 posted on 11/21/2015 4:46:11 AM PST by a fool in paradise (The goal of Socialism is Communism. Marx and Lenin were in agreement on this.)
[ Post Reply | Private Reply | To 5 | View Replies]

To: x_plus_one

Since 9-11, museums have bent over backward to praise and exhibit muslim/Islamic art. Oh, sooo ornate. They were prohibited from having figurative and representative art works.

Censorship was once thought to be a BAD thing.


32 posted on 11/21/2015 4:47:43 AM PST by a fool in paradise (The goal of Socialism is Communism. Marx and Lenin were in agreement on this.)
[ Post Reply | Private Reply | To 7 | View Replies]

To: GonzoII

If rogue Catholics set up a a self-proclaimed “Catholic State” somewhere, and proceeded to rape, behead and mass-murder everybody who disagreed, millions of good Catholics from all over the world would rise up, take arms, go there and destroy them.

Muslim passivity toward the Islamic State damns them by their silence.

After Paris, an anti-terrorism rally by Muslims drew THIRTY participants. Compared to thousands who protested against cartoons of Mohammed.


33 posted on 11/21/2015 4:52:21 AM PST by Travis McGee (www.EnemiesForeignAndDomestic.com)
[ Post Reply | Private Reply | To 1 | View Replies]

To: goldstategop
It takes a despot to keep them from destroying each other.

True in most cases. In Malaysia they have a benign despot, the king, with some control over the structure of the government. The rest is democratically elected. The Islamists are always trying to grab more power but have not succeeded so far.

34 posted on 11/21/2015 5:18:55 AM PST by palmer (Net "neutrality" = Obama turning the internet over to foreign enemies)
[ Post Reply | Private Reply | To 5 | View Replies]

To: GonzoII

How Islamic Are Islamic Terrorists? 100%

How Islamic Are Islamic Moderates? 0%


35 posted on 11/21/2015 5:39:19 AM PST by PIF (They came for me and mine ... now it is your turn ...)
[ Post Reply | Private Reply | To 1 | View Replies]

To: GonzoII

Do a Majority of Young French Muslims Support ISIS?

FrontPage Magazine-Nov 17, 2015

In the 18-to-24-year-old demographic, ISIS’ support jumped to 27%. Muslims comprise about a tenth of France’s population, so the results imply ...


36 posted on 11/21/2015 6:10:56 AM PST by stocksthatgoup (When the MSM and GOPe want your opinion they will give it to you.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: GonzoII

A typical suicidal terrorist is often driven by a belief that they have been a sinner earlier and the only way to go to Paradise is to be martyred (= killed for Allah) “

http://www.freerepublic.com/focus/news/3362440/posts?page=3#3


37 posted on 11/21/2015 6:43:18 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]

To: GonzoII

They are exactly like the original Moohamhead led Muslims, just with smart phones and guns.


38 posted on 11/21/2015 6:50:46 AM PST by Impy (They pull a knife, you pull a gun. That's the CHICAGO WAY, and that's how you beat the rats!)
[ Post Reply | Private Reply | To 1 | View Replies]

To: GonzoII

Important point about “Enlightenment thinking.” It’s also what Barry and his ilk engage in and why his policies are so badly flawed. Frankly, much that is wrong in the world harks back to it.


39 posted on 11/21/2015 7:05:49 AM PST by FourPeas ("Conservatism's worked every time it's been tried." -Rush)
[ Post Reply | Private Reply | To 1 | View Replies]

To: TigersEye; All
 photo Obama-Collage-2--Islam--2014-11-02_zpsbf468b01.jpg
40 posted on 11/21/2015 7:23:39 AM PST by Patton@Bastogne
[ Post Reply | Private Reply | To 2 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-2021-4041-45 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson