Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

Rep. Alan Grayson: Syria Intelligence Manipulated
US News ^ | September 5, 2013 | Steven Nelson

Posted on 09/05/2013 5:37:12 PM PDT by don-o

Rep. Alan Grayson, D-Fla., who is aggressively lobbying against a military strike on Syria, says the Obama administration has manipulated intelligence to push its case for U.S. involvement in the country's two-year civil war.

Grayson made the accusation in an interview published Wednesday by The Atlantic and offered more detail in a Thursday discussion with U.S. News. He says members of Congress are being given intelligence briefings without any evidence to support administration claims that Syrian leader Bashar Assad ordered the use of chemical weapons.

snip

He points to an article published by The Daily Caller that alleges the communications actually showed Syrian officers were surprised by the alleged chemical weapon attack. The communications, according to unnamed sources paraphrased in article, were intercepted by Israeli intelligence and "doctored so that it leads a reader to just the opposite conclusion."

"What they say in The Daily Caller is that [intercepted communications] would lead one to the opposite conclusion," Grayson said. "I don't know if it's right or wrong, [but] there's a very simple way to find out, that's for the administration to show me and other members of Congress" translated transcripts of the intercepts, he said.

(Excerpt) Read more at usnews.com ...


TOPICS: Breaking News; Israel; News/Current Events; Russia; US: Florida; United Kingdom; War on Terror
KEYWORDS: 911; alangrayson; criminalstatedept; florida; impeach; iran; israel; lebanon; maheralassad; russia; syria; thebrotherdidit; unitedkingdom; waronterror
Navigation: use the links below to view more comments.
first previous 1-2021-4041-6061-72 next last
To: VeniVidiVici

The combination of tech possessed by NRO/NSA could make it easy to send false radio data from anywhere.

Here is what I would do if I had the resources...
It would be no problem to drop a tiny software-defined-radio somewhere in Damascus and have a language expert in Langley send down any conversation they wanted the Israeli monitors on Mt Hermon to hear. (The Israelis must be monitoring from Mt Hermon as it’s the logical choice)

The signal would go out locally on normal frequencies used by Syrian officials. The SDR could be planted in Damascus by a method as simple as placing it inside some common object and simply mailing it to someone. This is a technique also useful for monitoring radio traffic in an area that cannot be picked up by an NRO sat directly because the frequency is too noisy from other sources. The SDR picks up the traffic and relays to the sat.

It reads like a cheap spy novel I know but this stuff is actually possible.


41 posted on 09/05/2013 7:01:17 PM PDT by Bobalu (Bobo the Wonder Marxist leads Operation Rodeo Clown against Syria)
[ Post Reply | Private Reply | To 16 | View Replies]

To: cripplecreek

I share your sentiment. However, you and I both have more reasons than this to kick O’s ass.


42 posted on 09/05/2013 7:05:16 PM PDT by optiguy (Winter is coming.)
[ Post Reply | Private Reply | To 2 | View Replies]

To: don-o
Pentagon Clarifies Hagel’s Comments That Russia Sent Chemical Weapons to Syria
ABC News ^ | September 4, 2013 | By Luis Martinez
"Well, the Russians supply them. Others are supplying them with those chemical weapons. They make some themselves."

Britain sold nerve gas chemicals to Syria 10 months after war began
Daily Record (Scotland) ^
BRITAIN allowed firms to sell chemicals to Syria...the UK Government has been allowing the sale of these ingredients to Syria...The chemical export licences...were only revoked six months later, when the European Union imposed tough sanctions on Assad’s regime...The Government...granting licences to companies to export to regimes such as Syria.

UK Arms Exports: more caution needed, warn MP's (UK exported hazardous chemicals to Syria
http://www.freerepublic.com/focus/f-news/3061406/posts


43 posted on 09/05/2013 7:06:03 PM PDT by familyop (We Baby Boomers are croaking in an avalanche of corruption smelled around the planet.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: don-o
I think a more productive prayer would be for the courage of the NCOs, junior and senior, to honor their oaths.

I think the still active duty “brass” have already abdicated their leadership roles, given the past few years of evidence.

But I am exactly that level of cynical, probably more than you can imagine.

44 posted on 09/05/2013 7:06:19 PM PDT by sarasmom (Extortion 17. A large number of Navy SEALs died on that mission. Ask why.)
[ Post Reply | Private Reply | To 36 | View Replies]

To: don-o
Grayson = stopped clock.

Scouts Out! Cavalry Ho!

45 posted on 09/05/2013 7:08:13 PM PDT by wku man (It's almost deer season, got your DEERGOGGLES on yet? http://www.youtube.com/watch?v=jexrnFq2fXY)
[ Post Reply | Private Reply | To 1 | View Replies]

To: don-o

Grayson? That guy in Florida who’s nuts?
Wow. This can’t be the same Grayson. This Grayson sounds honest and intelligent.


46 posted on 09/05/2013 7:10:41 PM PDT by Lancey Howard
[ Post Reply | Private Reply | To 1 | View Replies]

To: sarasmom

pentagon = pentagram
no coinky dink
Did you know that the groundbreaking for the pentagon was September 11th 1940something?


47 posted on 09/05/2013 7:32:59 PM PDT by SisterK (we are toast)
[ Post Reply | Private Reply | To 44 | View Replies]

To: don-o

Who would have ever thought that Grayson could be talking sense.

What’s the temperature in Hell?


48 posted on 09/05/2013 7:46:13 PM PDT by qaz123
[ Post Reply | Private Reply | To 1 | View Replies]

To: VeniVidiVici
RE: "I’m saying the intel was doctored but not by israel."

Dittos.
49 posted on 09/05/2013 8:01:08 PM PDT by Marine_Uncle (Galt level is not far away......)
[ Post Reply | Private Reply | To 16 | View Replies]

To: cripplecreek

I feel extremely ill! Agreeing with that Pr!ck on anything is very disturbing.


50 posted on 09/05/2013 8:14:11 PM PDT by SoldierDad (Proud dad of an Army Soldier who has survived 24 months of Combat deployment.)
[ Post Reply | Private Reply | To 2 | View Replies]

To: SunkenCiv; don-o

Aye-yay-yay, I never thought I’d see the day when I agree with Moonbat Grayson, and he disagrees with Obama.


51 posted on 09/05/2013 8:26:50 PM PDT by Berosus (I wish I had as much faith in God as liberals have in government.)
[ Post Reply | Private Reply | To 37 | View Replies]

To: don-o
>> Alan Grayson, D-Fla., who is aggressively lobbying against a military strike on Syria <<

He must be racist. Can't stand to see a person of color as commander-in-chief of our troops, Alan?

52 posted on 09/05/2013 10:04:37 PM PDT by BillyBoy (Liz Cheney's family supports gay marriage. Do you?)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Bobalu; gandalftb

Yes that would do it if the monitoring is just for the content of the message. However, these messages would be stored and when you check them in detail you can see the frequencies of the transmitted talk and if there are any distortions that can be compared to the other known radio transmitters etc. You can be fooled in the beginning but not after a couple of analysis. The take home message is no to trust the first analysis.


53 posted on 09/06/2013 3:12:20 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 41 | View Replies]

To: don-o

54 posted on 09/06/2013 3:15:54 AM PDT by McGruff (Strange times are these in which we live..)
[ Post Reply | Private Reply | To 1 | View Replies]

To: McGruff

Round up the usual suspects.


55 posted on 09/06/2013 3:20:42 AM PDT by Rocky (Obama is pure evil.)
[ Post Reply | Private Reply | To 54 | View Replies]

To: don-o
The biggest argument and rally point for going to war is an alleged transcript of an intercept where the a Syrian commander is discussing the gas attack, which the Obama Admin claims ties Syria's Government to responsibility for the gas attack

This alleged transcript is the primary and really only justification the Obama Admin is relying on to attack Syria.

Rep. Greyson asks Chuck Hagle about the reports the intercept is being falsified and doctored and actually the Syrians are shocked at the attack and are trying to determine where it came from.

The big point people seem to missing is Hagle’s comment THAT HE HAS ABSOLUTELY NO IDEA WHAT INTERCEPTED TRANSCRIPT GREYSON IS REFERRING TO AND SEEMS GENUINELY BLINDSIDED BY GREYSON'S QUESTION.

So, according to Sec of Defense Hagle’s sworn testimony, he is completely unaware of even the existence of the primary and only piece of “evidence” tying the Syrian Government to the responsibility for the gas attack that the Obama Admin is using as justification to attack Syria.

Based on media reports, Kerry is also being less than truthful in saying that the insurgents are not asking for military action. In fact, there are credible media reports that the original target list of facilities to attack was based on a wish list supplied to the Obama Admin directly by the Syrian insurgents and not by US military professionals.

56 posted on 09/06/2013 4:03:04 AM PDT by rdcbn
[ Post Reply | Private Reply | To 1 | View Replies]

To: don-o

I think I have lost it. Grayson actually makes sense and I agree with him. I need a shower.


57 posted on 09/06/2013 5:10:17 AM PDT by imskylark
[ Post Reply | Private Reply | To 1 | View Replies]

To: Farmer Dean

When you lose Special Ed and I agree with Alan Grayson on anything the temperature in hell must be well below zero.


58 posted on 09/06/2013 6:00:14 AM PDT by kempster
[ Post Reply | Private Reply | To 7 | View Replies]

To: Cheerio

Who photoshopped the fork out of his tongue?


59 posted on 09/06/2013 10:15:42 AM PDT by BykrBayb (Somewhere, my flower is there. ~ Þ)
[ Post Reply | Private Reply | To 5 | View Replies]

To: don-o

Its the sign of the apocalypse!!!!!


60 posted on 09/06/2013 10:25:32 AM PDT by dragonblustar
[ Post Reply | Private Reply | To 1 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-2021-4041-6061-72 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson