Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

Ukrainian attack on Crimean port damages Russian warship, Moscow says
NY Post ^

Posted on 12/26/2023 10:03:16 AM PST by Eleutheria5

A Ukrainian attack on the Crimean port of Feodosia damaged a large Russian landing ship and killed one person, Moscow said on Tuesday after Kyiv said it had destroyed an important Russian warship.

The Russian defense ministry was cited by the Interfax news agency as saying that Ukraine had used air-launched missiles to attack Feodosia and that the ‘Novocherkassk’ large landing ship had been damaged in the raid.

The ‘Novocherkassk,’ which was built in Poland and entered service in the late 1980s, is designed for amphibious landings and can carry various types of armored vehicles, including tanks.

Footage posted on several Russian news outlets on the Telegram messaging app, purportedly from the port, showed powerful explosions detonating and fires burning.

Sergei Aksyonov, the Russian-installed governor of Crimea, said on the Telegram messaging app that one person had been killed, two injured and six people evacuated from their homes.

Although a Ukrainian counteroffensive has made little in the way of battlefield gains and the Russian military has regained the initiative in several places, Ukraine has been able to launch a series of attacks on Crimea, the headquarters of Russia’s Black Sea Fleet, inflicting serious damage.

The Ukrainian air force said its pilots had attacked Feodosia at about 2:30 a.m. local time with cruise missiles, destroying the ‘Novocherkassk.’

“And the fleet in Russia is getting smaller and smaller! Thanks to the Air Force pilots and everyone involved for the filigree work!” the commander of Ukraine’s air force, Mykola Oleshchuk, said on Telegram.

.....

(Excerpt) Read more at nypost.com ...


TOPICS: News/Current Events; Russia; Ukraine; War
KEYWORDS: aksyonov; crimea; feodosia; novocherkassk; ukraine
Navigation: use the links below to view more comments.
first 1-2021-4041-44 next last
Good to see some more movement. Bad to see ships still in Crimea. Was it "destroyed" or only "damaged"? Impossible to say without pictures.
1 posted on 12/26/2023 10:03:17 AM PST by Eleutheria5
[ Post Reply | Private Reply | View Replies]

To: Eleutheria5

Close video big boom
Sound up
Ukrainian Air Force struck Feodosia, Crimea, taking out Russia’s “Novocherkask” landing ship
https://rumble.com/v43gdkq-ukrainian-air-force-struck-feodosia-crimea-taking-out-russias-novocherkask-.html


2 posted on 12/26/2023 10:04:28 AM PST by janetjanet998 (Legacy media including youtube are the enemy of the people and must die)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Eleutheria5

Well, the published videos show huge explosions which (if coming from the actual ship) would point more toward total destruction and not mere damage. But you’re right, without actual pictures we (the public) can’t be sure.


3 posted on 12/26/2023 10:08:38 AM PST by House Atreides (I’m now ULTRA-MAGA. -PRO-MAX)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Eleutheria5

Ukraine has destroyed 20% of the Russian Black fleet, while Russia has liberated 20% of Eastern Ukraine. Seems like an equitable swap.


4 posted on 12/26/2023 10:08:47 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 1 | View Replies]

To: Eleutheria5
What about this don't you understand, blockhead? Ukraine just suffered its most devastating loss since losing Bakhmut:

Russian Forces Take Heavily Fortified Town of Maryinka in Biggest Triumph Since Bakhmut

The year is ending on an upbeat note for the Russian Federation troops that have just conquered the heavily fortified town of Maryinka, in the outskirts of Donetsk city.

This is a major development, the biggest since Moscow troops regained the initiative, and also the greatest achievement since they gained control of Avdiivka (Bakhmut) in May.

By taking Maryinka, the Russians have significantly pushed back the Ukrainian artillery. For years, Kiev used Maryinka has a key launching pad for drone and artillery strikes against civilians in Donetsk.

5 posted on 12/26/2023 10:09:21 AM PST by Kazan
[ Post Reply | Private Reply | To 1 | View Replies]

To: Eleutheria5
Russian blogger:

The Black Sea Fleet lost the Novocherkassk landing ship.

Another unpleasant news came from Crimea. Last night, enemy aircraft attacked the port of Feodosia. Unfortunately, the large landing ship Novocherkassk came under attack. The detonation of the ammunition that was on board was visible for kilometers. We managed to find out the details of the night attack of Feodosia. Firstly, the attack on the BDK was carried out by Ukrainian aircraft using long-range missiles of the Storm Shadow type . According to our information, at least 3 Su-24 fighters were involved in the attack. Moreover, one of them distracted the air defense while approaching Crimea from Odessa through the Black Sea. The other two fired missiles from the Kherson direction. The interlocutors suggested that the enemy Su-shki flew over the front line or came very close to it.

This opportunity arose after the Russian troops lost several Su-34 fighters at once. We told you that after this tragedy, some pilots refuse to carry out combat missions. On the front sector near the bridgehead on the left bank of the Dnieper, the Ukrainian Armed Forces use a modern Western-style air defense system (probably Patriot).

Secondly, sources confirmed that the Novocherkassk BDK was transporting weapons and ammunition . Our interlocutors in the fleet refused to say what exactly was on board, but noted that this was a big loss for the front. The Ukrainians are already shouting that there could be Iranian drones and ammunition on board, but we have no such information. However, the scale of the damage was serious, which does not lead to the most optimistic thoughts.

Thirdly, the ship is unlikely to be restored . In the morning we contacted our sources in the navy, they say that the Novocherkassk has suffered greatly and with a 90% probability it will be impossible to return it to service. At least 21 sailors were killed as a result of the enemy strike. Some of them, for some unknown reason, were left to spend the night on the ship. Some were involved in guarding the ship. Great tragedy.

Let us recall that in November we stated that Russia is losing its Black Sea Fleet step by step. Perhaps it's time to think about withdrawing at least the most valuable ships to Novorossiysk, and perhaps further?

https://t.me/kremlin_secrets/3336

https://twitter.com/bayraktar_1love/status/1739597910206001494

Remains of the Ropucha-class landing ship Novocherkask was found in different parts of Feodosia. Imagine how big that explosion was.

https://twitter.com/noelreports/status/1739633516172747148
video

6 posted on 12/26/2023 10:10:59 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Eleutheria5
Russia Non-Stop Striking Every Inch Of Novomykhailivka. Marinka Has Fallen.
7 posted on 12/26/2023 10:14:55 AM PST by Kazan
[ Post Reply | Private Reply | To 1 | View Replies]

To: Kazan
For years, Kiev used Maryinka has a key launching pad for drone and artillery strikes against civilians in Donetsk.

Why are you highlighting something that is clearly false? There has been no deliberate targeting of civilians. Why are you repeating this bilge? If this is the standard for the reliability of the report then the whole thing can be disregarded.

8 posted on 12/26/2023 10:17:00 AM PST by Petrosius
[ Post Reply | Private Reply | To 5 | View Replies]

To: Eleutheria5

It’s just a little damage. Some bondo, some primer, and a little elbow grease and it’ll be good as new!

ROTFLMAO!


9 posted on 12/26/2023 10:20:31 AM PST by MeganC (There is nothing feminine about feminism. )
[ Post Reply | Private Reply | To 1 | View Replies]

To: AdmSmith

That analysis seems very credible.


10 posted on 12/26/2023 10:21:15 AM PST by ansel12 ((NATO warrior under Reagan, and RA under Nixon, bemoaning the pro-Russians from Vietnam to Ukraine.))
[ Post Reply | Private Reply | To 6 | View Replies]

To: Kazan

2/29/2024


11 posted on 12/26/2023 10:21:46 AM PST by MeganC (There is nothing feminine about feminism. )
[ Post Reply | Private Reply | To 5 | View Replies]

To: Eleutheria5

The video of the explosion is so large it is hard to see how the ship could have survived. Well done Ukraine!


12 posted on 12/26/2023 10:22:14 AM PST by Midwesterner53
[ Post Reply | Private Reply | To 1 | View Replies]

To: Eleutheria5; All

Novocherkassk: 4,400 artillery shells, 280 Grad rockets, 62 crew members destroyed.


13 posted on 12/26/2023 10:23:11 AM PST by marcusmaximus
[ Post Reply | Private Reply | To 1 | View Replies]

To: Petrosius; Kazan

Kazan has compulsions that he can’t control.

If you read literally any thread involving Russia or Putin you will see his tourette syndrome-like expulsions everywhere, rarely matching the actual thread subject and usually just repetitive spamming that has nothing to with the thread itself but a necessary and compulsive emotional release for him.


14 posted on 12/26/2023 10:29:08 AM PST by ansel12 ((NATO warrior under Reagan, and RA under Nixon, bemoaning the pro-Russians from Vietnam to Ukraine.))
[ Post Reply | Private Reply | To 8 | View Replies]

To: Petrosius

He’s a Russian propagandist.


15 posted on 12/26/2023 10:34:04 AM PST by ought-six (Multiculturalism is national suicide, and political correctness is the cyanide capsule. )
[ Post Reply | Private Reply | To 8 | View Replies]

Comment #16 Removed by Moderator

To: Petrosius

It’s been going on since 2014. Check the OSCE reports. And human rights NGOs.

Amnesty International report, 2015:

“The reported violations include an attack on a humanitarian aid line, a market place in Donestk and indiscriminate shelling of homes and streets in Debaltseve.”

https://www.amnesty.org/en/latest/news/2015/02/ukraine-horror-civilian-bloodshed-indiscriminate-attacks/

Extremely pro-NATO HRW even says so. Report from 2014:

https://www.hrw.org/news/2014/07/24/ukraine-unguided-rockets-killing-civilians

There were reports of Ukrainian attacks killing civilians in Donetsk last month ... It’s been nonstop for years.


17 posted on 12/26/2023 10:51:25 AM PST by CatHerd (Whoever said "All's fair in love and war" probably never participated in either.)
[ Post Reply | Private Reply | To 8 | View Replies]

To: Eleutheria5

What is stupid about us spending all that money on Ukraine is we spend it then we tie their hands behind their back and say don’t use it on Russian territory. If they are going to fight, let them fight.


18 posted on 12/26/2023 10:58:01 AM PST by for-q-clinton (Cancel Culture IS fascism...Let's start calling it that!)
[ Post Reply | Private Reply | To 1 | View Replies]

To: ansel12

—”his tourette syndrome-like expulsions everywhere, rarely matching the actual thread subject and usually just repetitive spamming “

Difficult times inside Russia, some take jobs in troll factories hoping to avoid conscription.
Their output is measured by volume, so they tend to post any and all BS.

The technique is referred to as the “firehose of falsehood”.
Just keep pumping the BS...


19 posted on 12/26/2023 11:25:02 AM PST by DUMBGRUNT ( "The enemy has overrun us. We are blowing up everything. Vive la France!"Dien Bien Phu last message)
[ Post Reply | Private Reply | To 14 | View Replies]

To: ansel12

20 posted on 12/26/2023 11:26:29 AM PST by DUMBGRUNT ( "The enemy has overrun us. We are blowing up everything. Vive la France!"Dien Bien Phu last message)
[ Post Reply | Private Reply | To 14 | View Replies]


Navigation: use the links below to view more comments.
first 1-2021-4041-44 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson