Free Republic
Browse · Search
News/Activism
Topics · Post Article

Good to see some more movement. Bad to see ships still in Crimea. Was it "destroyed" or only "damaged"? Impossible to say without pictures.
1 posted on 12/26/2023 10:03:17 AM PST by Eleutheria5
[ Post Reply | Private Reply | View Replies ]


To: Eleutheria5

Close video big boom
Sound up
Ukrainian Air Force struck Feodosia, Crimea, taking out Russia’s “Novocherkask” landing ship
https://rumble.com/v43gdkq-ukrainian-air-force-struck-feodosia-crimea-taking-out-russias-novocherkask-.html


2 posted on 12/26/2023 10:04:28 AM PST by janetjanet998 (Legacy media including youtube are the enemy of the people and must die)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Eleutheria5

Well, the published videos show huge explosions which (if coming from the actual ship) would point more toward total destruction and not mere damage. But you’re right, without actual pictures we (the public) can’t be sure.


3 posted on 12/26/2023 10:08:38 AM PST by House Atreides (I’m now ULTRA-MAGA. -PRO-MAX)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Eleutheria5

Ukraine has destroyed 20% of the Russian Black fleet, while Russia has liberated 20% of Eastern Ukraine. Seems like an equitable swap.


4 posted on 12/26/2023 10:08:47 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Eleutheria5
What about this don't you understand, blockhead? Ukraine just suffered its most devastating loss since losing Bakhmut:

Russian Forces Take Heavily Fortified Town of Maryinka in Biggest Triumph Since Bakhmut

The year is ending on an upbeat note for the Russian Federation troops that have just conquered the heavily fortified town of Maryinka, in the outskirts of Donetsk city.

This is a major development, the biggest since Moscow troops regained the initiative, and also the greatest achievement since they gained control of Avdiivka (Bakhmut) in May.

By taking Maryinka, the Russians have significantly pushed back the Ukrainian artillery. For years, Kiev used Maryinka has a key launching pad for drone and artillery strikes against civilians in Donetsk.

5 posted on 12/26/2023 10:09:21 AM PST by Kazan
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Eleutheria5
Russian blogger:

The Black Sea Fleet lost the Novocherkassk landing ship.

Another unpleasant news came from Crimea. Last night, enemy aircraft attacked the port of Feodosia. Unfortunately, the large landing ship Novocherkassk came under attack. The detonation of the ammunition that was on board was visible for kilometers. We managed to find out the details of the night attack of Feodosia. Firstly, the attack on the BDK was carried out by Ukrainian aircraft using long-range missiles of the Storm Shadow type . According to our information, at least 3 Su-24 fighters were involved in the attack. Moreover, one of them distracted the air defense while approaching Crimea from Odessa through the Black Sea. The other two fired missiles from the Kherson direction. The interlocutors suggested that the enemy Su-shki flew over the front line or came very close to it.

This opportunity arose after the Russian troops lost several Su-34 fighters at once. We told you that after this tragedy, some pilots refuse to carry out combat missions. On the front sector near the bridgehead on the left bank of the Dnieper, the Ukrainian Armed Forces use a modern Western-style air defense system (probably Patriot).

Secondly, sources confirmed that the Novocherkassk BDK was transporting weapons and ammunition . Our interlocutors in the fleet refused to say what exactly was on board, but noted that this was a big loss for the front. The Ukrainians are already shouting that there could be Iranian drones and ammunition on board, but we have no such information. However, the scale of the damage was serious, which does not lead to the most optimistic thoughts.

Thirdly, the ship is unlikely to be restored . In the morning we contacted our sources in the navy, they say that the Novocherkassk has suffered greatly and with a 90% probability it will be impossible to return it to service. At least 21 sailors were killed as a result of the enemy strike. Some of them, for some unknown reason, were left to spend the night on the ship. Some were involved in guarding the ship. Great tragedy.

Let us recall that in November we stated that Russia is losing its Black Sea Fleet step by step. Perhaps it's time to think about withdrawing at least the most valuable ships to Novorossiysk, and perhaps further?

https://t.me/kremlin_secrets/3336

https://twitter.com/bayraktar_1love/status/1739597910206001494

Remains of the Ropucha-class landing ship Novocherkask was found in different parts of Feodosia. Imagine how big that explosion was.

https://twitter.com/noelreports/status/1739633516172747148
video

6 posted on 12/26/2023 10:10:59 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Eleutheria5
Russia Non-Stop Striking Every Inch Of Novomykhailivka. Marinka Has Fallen.
7 posted on 12/26/2023 10:14:55 AM PST by Kazan
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Eleutheria5

It’s just a little damage. Some bondo, some primer, and a little elbow grease and it’ll be good as new!

ROTFLMAO!


9 posted on 12/26/2023 10:20:31 AM PST by MeganC (There is nothing feminine about feminism. )
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Eleutheria5

The video of the explosion is so large it is hard to see how the ship could have survived. Well done Ukraine!


12 posted on 12/26/2023 10:22:14 AM PST by Midwesterner53
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Eleutheria5; All

Novocherkassk: 4,400 artillery shells, 280 Grad rockets, 62 crew members destroyed.


13 posted on 12/26/2023 10:23:11 AM PST by marcusmaximus
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Eleutheria5

What is stupid about us spending all that money on Ukraine is we spend it then we tie their hands behind their back and say don’t use it on Russian territory. If they are going to fight, let them fight.


18 posted on 12/26/2023 10:58:01 AM PST by for-q-clinton (Cancel Culture IS fascism...Let's start calling it that!)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Eleutheria5

Destroyed as can be seen in the pictures.


28 posted on 12/26/2023 12:12:08 PM PST by freeandfreezing
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Eleutheria5

Good to see some more movement. Bad to see ships still in Crimea. Was it “destroyed” or only “damaged”? Impossible to say without pictures.

Annihilated as per this video.

Ropucha-class Landing Ship Novocherkassk Confirmed SUNK By Storm Shadow in Photo
https://www.youtube.com/watch?v=4RlFtg6CJ7I


36 posted on 12/26/2023 2:40:24 PM PST by Steven Scharf
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Eleutheria5

The damaged ship spontaneously spread chunks of itself all around the city in a goodwill gesture and in the hopes that the people could put the jigsaw puzzle back together again, along with the pieces of meat from the former crew.


37 posted on 12/26/2023 2:45:35 PM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 1 | View Replies ]

Free Republic
Browse · Search
News/Activism
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson