Replies

To: Eleutheria5

It’s just a little damage. Some bondo, some primer, and a little elbow grease and it’ll be good as new!

ROTFLMAO!

9 posted on 12/26/2023 10:20:31 AM PST by MeganC (There is nothing feminine about feminism. )

To: MeganC

It's just a little damage. Some bondo, some primer, and a little elbow grease and it'll be good as new!

or ...It's just a flesh wound..

24 posted on 12/26/2023 11:45:40 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794