Free Republic
Browse · Search
News/Activism
Topics · Post Article

To: MeganC
It's just a little damage. Some bondo, some primer, and a little elbow grease and it'll be good as new!

or ...It's just a flesh wound..

https://www.youtube.com/watch?v=UijhbHvxWrA

24 posted on 12/26/2023 11:45:40 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 9 | View Replies ]


To: AdmSmith

Ha!


25 posted on 12/26/2023 11:54:01 AM PST by MeganC (There is nothing feminine about feminism. )
[ Post Reply | Private Reply | To 24 | View Replies ]

Free Republic
Browse · Search
News/Activism
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson