Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

Heroic ‘Ghost of Kyiv’ fighter doesn’t actually exist, Ukraine admits
NY Post ^ | May 1, 2022 | Jackie Salo

Posted on 05/02/2022 12:10:54 AM PDT by Mount Athos

The “Ghost of Kyiv” is a myth, Ukrainian officials admitted over the weekend.

After several news outlets last week identified the legendary, mysterious, hero fighter pilot as a 29-year-old dad recently killed in battle with the Russians, military officials acknowledged Saturday that there was no such person.

“The ghost of Kyiv is a superhero-legend, whose character was created by Ukrainians!” Ukraine’s Air Force Command wrote on Facebook.

The reputed hero had been credited with taking out as many as 40 Russian aircraft until he was shot down March 13 while battling an “overwhelming” number of enemy forces, the Times of London had reported.

The Times identified the supposed Ukrainian war hero as Major Stepan Tarabalka.

But while Tarabalka was a distinguished war hero, he was not the “Ghost” — because there never was such a person, Ukraine said.

“Hero of Ukraine Stepan Tarabalka is NOT ‘Ghost of Kyiv’ and he did NOT shoot down 40 planes,” said the country’s Air Force Command.

Instead, the moniker belongs collectively to all of Ukraine’s hero fighter pilots, military officials said.

“The #GhostOfKyiv is alive. It embodies the collective spirit of the highly qualified pilots of the Tactical Aviation Brigade who are successfully defending #Kyiv and the region,” the command tweeted.

The Ukrainian government had previously been key in creating and perpetuating the myth of a single brave and particularly on-target fighter pilot.

“People call him the Ghost of Kyiv. And rightly so,” the government tweeted in February of the reputed mysterious figure, saying the pilot had “already become a nightmare for invading Russian aircraft.”

But many people questioned whether the “Ghost” was real, as a video purporting to be evidence of the fighter turned out to instead be from a video game.

(Excerpt) Read more at nypost.com ...


TOPICS: Foreign Affairs; News/Current Events; Russia; US: New York
KEYWORDS: agitprop; andagain; chechens; chechnya; coloneltomb; fakenews; ghostofkiev; hateamericafirst; humblegunnerkaren; hyde; jackiesalo; myth; newyork; newyorkcity; newyorkpost; pedosforputin; propaganda; putinlovertrollsonfr; putinsbuttboys; putinworshippers; russia; russianaggression; sam; samhyde; ukraine; ukrainianpropaganda; warpropaganda; zottherussiantrolls
Navigation: use the links below to view more comments.
first 1-2021-4041-44 next last

1 posted on 05/02/2022 12:10:54 AM PDT by Mount Athos
[ Post Reply | Private Reply | View Replies]

To: Mount Athos

But, if he did, he would be Hall of Fame material, for sure.


2 posted on 05/02/2022 12:18:18 AM PDT by Wally_Kalbacken
[ Post Reply | Private Reply | To 1 | View Replies]

To: Mount Athos

Well 🙄


3 posted on 05/02/2022 12:23:00 AM PDT by Equine1952
[ Post Reply | Private Reply | To 1 | View Replies]

Well, there’s that pianist and dancer dude.


4 posted on 05/02/2022 12:27:07 AM PDT by Gene Eric (Don't be a statist!)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Mount Athos

There are people right here on Free Republic gullible enough to have believed it.


5 posted on 05/02/2022 12:32:44 AM PDT by Trump20162020
[ Post Reply | Private Reply | To 1 | View Replies]

To: All
And I have to wonder how many Freepers believed the Ghost of Kyiv was real?
6 posted on 05/02/2022 12:33:10 AM PDT by Doofer
[ Post Reply | Private Reply | To 4 | View Replies]

To: Trump20162020

or the countless Ukranian potato farmer peasants who disabled columns of Russian tanks longer then the Highway of Death in the Gulf War?


7 posted on 05/02/2022 12:37:20 AM PDT by Jaysin (Trump can’t be beat, unless the democrats cheat)
[ Post Reply | Private Reply | To 5 | View Replies]

To: All

.
Everyone over 30 knew this.


8 posted on 05/02/2022 12:40:50 AM PDT by AnthonySoprano (Cornpop was a bad dude)
[ Post Reply | Private Reply | To 7 | View Replies]

To: Mount Athos

What other lies are they telling?


9 posted on 05/02/2022 12:45:30 AM PDT by minnesota_bound (Need more money to buy gas)
[ Post Reply | Private Reply | To 1 | View Replies]

To: minnesota_bound

The deaths of all those Russian generals and soldiers is definitely a lie as well.


10 posted on 05/02/2022 1:43:34 AM PDT by BillyCuccio (MAGA)
[ Post Reply | Private Reply | To 9 | View Replies]

To: Mount Athos

Russian Nerve Gas attacks, Mobile Crematoriums…. The lies are legion


11 posted on 05/02/2022 3:03:11 AM PDT by Jan_Sobieski (Sanctification)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Jan_Sobieski

Probably all wars are built on lies, but this one has got some real winners. They’re so transparent and exaggerated that they would almost be funny - if they weren’t egging us on to nuclear war.


12 posted on 05/02/2022 4:04:27 AM PDT by livius
[ Post Reply | Private Reply | To 11 | View Replies]

To: Mount Athos

What else is the Ukrainian government lying about? I support neither side; I think both governments are crooked, and am convinced democrats and RINOS are bent on getting us directly involved in a huge war.
They mistakenly believe that Americans would be reticent to change government if we were at war. I doubt that; we may be stupid, but we don’t have fits.


13 posted on 05/02/2022 4:09:46 AM PDT by Flaming Conservative ((Pray without ceasing))
[ Post Reply | Private Reply | To 1 | View Replies]

To: Mount Athos

There is a long list of fake stories coming out of Ukraine.

Their Ministry of Defense should be renamed Ministry of Lies.


14 posted on 05/02/2022 4:51:42 AM PDT by mac_truck (aide toi et dieu t'aidera )
[ Post Reply | Private Reply | To 1 | View Replies]

To: Mount Athos
“The ghost of Kyiv is a superhero-legend, whose character was created by Ukrainians!” Ukraine’s Air Force Command wrote on Facebook.

I'm guessing he was a CIA creation...

15 posted on 05/02/2022 4:57:33 AM PDT by GOPJ (G wanumballs and illegals: https://www.youtube.com/watch?time_continue=45&v=LPjzfGChGlE)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Mount Athos
"They also said artificial sweeteners were safe, WMDs were in Iraq and Anna Nicole married for love."


16 posted on 05/02/2022 4:59:20 AM PDT by moovova
[ Post Reply | Private Reply | To 1 | View Replies]

To: AdmSmith

You swallowed the lie hook, line, and sinker. Kiev has a has a stable of useful idiots on FR.


17 posted on 05/02/2022 5:42:51 AM PDT by WMarshal (Neocons and leftists are the same species of vicious rat.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Doofer

I knew the ghost of Kiev was propaganda.

The shark of Kiev isn’t though. The guy free dives and so far has taken out 6 Russian subs with a knife.


18 posted on 05/02/2022 6:07:38 AM PDT by Bulwyf
[ Post Reply | Private Reply | To 6 | View Replies]

To: WMarshal

sure https://theconversation.com/ukraine-war-vranyo-russian-for-when-you-lie-and-everyone-knows-it-but-you-dont-care-181100 ;-)


19 posted on 05/02/2022 6:09:52 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 17 | View Replies]

To: Mount Athos

Has our new Ministry of Truth debunked this yet?

/s


20 posted on 05/02/2022 6:11:21 AM PDT by logi_cal869 (-cynicus the "concern troll" a/o 10/03/2018 /!i!! &@$%&*(@ -)
[ Post Reply | Private Reply | To 1 | View Replies]


Navigation: use the links below to view more comments.
first 1-2021-4041-44 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson