Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

3.2 Billion Leaked Passwords Contain 1.5 Million Records with Government Emails
https://thehackernews.com ^ | April 26, 2021  Ravie Lakshmanan

Posted on 04/26/2021 9:34:09 AM PDT by Red Badger

A staggering number of 3.28 billion passwords linked to 2.18 billion unique email addresses were exposed in what's one of the largest data dumps of breached usernames and passwords.

In addition, the leak includes 1,502,909 passwords associated with email addresses from government domains across the world, with the U.S. government alone taking up 625,505 of the exposed passwords, followed by the U.K (205,099), Australia (136,025), Brazil (68,535), and Canada (50,726).

The findings come from an analysis of a massive 100GB data set called "COMB21" — aka Compilation of Many Breaches — that was published for free in an online cybercrime forum earlier this February by putting together data from multiple leaks in different companies and organizations that occurred over the years.

It's worth noting that a leak doesn't imply a breach of public administration systems. The passwords are said to have been obtained via techniques such as password hash cracking after being stolen or through phishing attacks and eavesdropping on insecure, plaintext connections.

The top 10 U.S. government domains affected by the leak are as follows:

State Department - state.gov (29,144) Veterans Affairs Department - va.gov (28,937) Department of Homeland Security - dhs.gov (21,575) National Aeronautics and Space Administration - nasa.gov (15,665) Internal Revenue Service - irs.gov (10,480) Center for Disease Control and Prevention - cdc.gov (8,904) Department of Justice - usdoj.gov (8,857) Social Security Administration - ssa.gov (8,747) U.S. Postal Service - usps.gov (8,205), and Environmental Protection Agency - epa.gov (7,986) Interestingly, this leak also includes 13 credentials linked to emails of the Oldsmar water plant in Florida, as previously reported by CyberNews. However, there's no evidence that the breached passwords were used to carry out the cyberattack in February. In contrast, only 18,282 passwords related to Chinese government domains and 1,964 passwords from those related to Russia were laid bare.

"It is an indication that the passwords in these countries, made up of local alphabets, are less targeted by hackers. It is an unexpected layer of protection in relation to the Roman alphabet," said Syhunt Founder and Chief Visionary Officer (CVO) Felipe Daragon.

On a related note, a notorious threat actor named ShinyHunters has posted an alleged database consisting of 20 million BigBasket users for free, almost five months after the Indian online grocery delivery startup confirmed a data breach. According to Under the Breach's Alon Gal, the database includes users' email addresses, phone numbers, residential addresses, hashed passwords, dates of birth, and order histories.

In the past, ShinyHunters has been connected to the sale of personal data from several companies, including Zoosk, SocialShare, Tokopedia, TeeSpring, Mindful, Minted, Chatbooks, Dave, Promo, Mathway, Wattpad, MeetMindful.com, and StarTribune.

Users who have had their information exposed are strongly advised to change their existing passwords.



TOPICS: Business/Economy; Crime/Corruption; Culture/Society; Government
KEYWORDS:
Navigation: use the links below to view more comments.
first 1-2021-28 next last

1 posted on 04/26/2021 9:34:09 AM PDT by Red Badger
[ Post Reply | Private Reply | View Replies]

To: ShadowAce; dayglored; Swordmaker

Pingy! Ping! Ping!..................


2 posted on 04/26/2021 9:34:51 AM PDT by Red Badger ("We've always been at war with Climate Change, Winston."..............................)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Red Badger

That’s amazing! I have the same combination on my luggage.


3 posted on 04/26/2021 9:37:12 AM PDT by BenLurkin (The above is not a statement of fact. It is either opinion, or satire. Or both.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: rdb3; JosephW; martin_fierro; Still Thinking; zeugma; Vinnie; ironman; Egon; raybbr; AFreeBird; ...

4 posted on 04/26/2021 9:38:05 AM PDT by ShadowAce (Linux - The Ultimate Windows Service Pack )
[ Post Reply | Private Reply | To 1 | View Replies]

No plain passwords should stored anymore. High entropy salted hashes should be the case for quite some time now. Guessing these exposed passwords are from old systems.


5 posted on 04/26/2021 9:42:51 AM PDT by Gene Eric (Don't be a statist!)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Red Badger

OLD OLD story.


6 posted on 04/26/2021 9:43:11 AM PDT by TexasGator (Z1z)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Gene Eric

“Guessing these exposed passwords are from old systems.”

A google search reveals the whole story:

https://www.tomsguide.com/news/3-2-billion-passwords-leaked


7 posted on 04/26/2021 9:45:58 AM PDT by TexasGator (Z1z)
[ Post Reply | Private Reply | To 5 | View Replies]

To: ShadowAce

https://external-content.duckduckgo.com/iu/?u=https%3A%2F%2Fmedia.tenor.co%2Fimages%2F84d440d70af47873b7aa80204ed0543e%2Fraw&f=1&nofb=1


8 posted on 04/26/2021 9:47:08 AM PDT by Red Badger ("We've always been at war with Climate Change, Winston."..............................)
[ Post Reply | Private Reply | To 4 | View Replies]

To: Gene Eric

Didn’t even read the excerpt?

“The passwords are said to have been obtained via techniques such as password hash cracking”


9 posted on 04/26/2021 9:53:17 AM PDT by Pollard
[ Post Reply | Private Reply | To 5 | View Replies]

To: ShadowAce; Red Badger

This was very bad “Report: Chinese hackers stole data from up to 4 million Federal Employees”
https://freerepublic.com/focus/f-news/3296974/posts?page=1


10 posted on 04/26/2021 9:56:41 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 4 | View Replies]

To: Pollard; Gene Eric
How CrackStation Works

CrackStation uses massive pre-computed lookup tables to crack password hashes. These tables store a mapping between the hash of a password, and the correct password for that hash. The hash values are indexed so that it is possible to quickly search the database for a given hash. If the hash is present in the database, the password can be recovered in a fraction of a second. This only works for "unsalted" hashes. For information on password hashing systems that are not vulnerable to pre-computed lookup tables, see our hashing security page.

Crackstation's lookup tables were created by extracting every word from the Wikipedia databases and adding with every password list we could find. We also applied intelligent word mangling (brute force hybrid) to our wordlists to make them much more effective. For MD5 and SHA1 hashes, we have a 190GB, 15-billion-entry lookup table, and for other hashes, we have a 19GB 1.5-billion-entry lookup table.


Crackstation cracked these four unsalted sha256 hashes in a fraction of a second.
c11083b4b0a7743af748c85d343dfee9fbb8b2576c05f3a7f0d632b0926aadfc
08eac03b80adc33dc7d8fbe44b7c7b05d3a2c511166bdb43fcb710b03ba919e7
e4ba5cbd251c98e6cd1c23f126a3b81d8d8328abc95387229850952b3ef9f904
5206b8b8a996cf5320cb12ca91c7b790fba9f030408efe83ebb83548dc3007bd

11 posted on 04/26/2021 10:10:54 AM PDT by ProtectOurFreedom (Real happiness is one that you share)
[ Post Reply | Private Reply | To 9 | View Replies]

To: ProtectOurFreedom

Two Factor Authentication may be aggravating but is probably a good thing to do.


12 posted on 04/26/2021 10:22:04 AM PDT by Pollard
[ Post Reply | Private Reply | To 11 | View Replies]

To: ShadowAce

Most of these passwords are stored on web servers.

This is not about local client storage of passwords.

Unix/Linux makes up 60% of all web servers.


13 posted on 04/26/2021 10:29:53 AM PDT by Alas Babylon! ("You, the American people, are my only special interest." --President Donald J. Trump)
[ Post Reply | Private Reply | To 4 | View Replies]

To: Pollard

I use TFA all the time (at least where it is available). It is a pain, but it is obviously secure because you have to have 1) Something you KNOW and 2) Some physical thing you HAVE.

I also use a YubiKey USB key. It’s a tiny USB device that you plug into any USB port. It is also the physical thing you HAVE and it provides strong security. I’ve switched away from it more and more and use my phone for TFA.


14 posted on 04/26/2021 10:47:32 AM PDT by ProtectOurFreedom (Real happiness is one that you share)
[ Post Reply | Private Reply | To 12 | View Replies]

To: Pollard

Said salted.


15 posted on 04/26/2021 10:53:21 AM PDT by Gene Eric (Don't be a statist!)
[ Post Reply | Private Reply | To 9 | View Replies]

To: ProtectOurFreedom

+1


16 posted on 04/26/2021 10:54:19 AM PDT by Gene Eric (Don't be a statist!)
[ Post Reply | Private Reply | To 11 | View Replies]

To: Red Badger

...on Biden’s watch.


17 posted on 04/26/2021 11:06:23 AM PDT by moovova (Yo GOP....we won't forget.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: ProtectOurFreedom

What is a salted hash please?


18 posted on 04/26/2021 11:07:07 AM PDT by grey_whiskers (The opinions are solely those of the author and are subject to change with out notice.)
[ Post Reply | Private Reply | To 11 | View Replies]

To: grey_whiskers
"In cryptography, a salt is random data that is used as an additional input to a one-way function that hashes data, a password or passphrase. Salts are used to safeguard passwords in storage. Historically a password was stored in plaintext on a system, but over time, additional safeguards were developed to protect a user's password against being read from the system. A salt is one such method."

Hash function

Salt (cryptography)

19 posted on 04/26/2021 11:22:06 AM PDT by ProtectOurFreedom (Real happiness is one that you share)
[ Post Reply | Private Reply | To 18 | View Replies]

To: ProtectOurFreedom

Thanks.


20 posted on 04/26/2021 11:51:11 AM PDT by grey_whiskers (The opinions are solely those of the author and are subject to change with out notice.)
[ Post Reply | Private Reply | To 19 | View Replies]


Navigation: use the links below to view more comments.
first 1-2021-28 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson