Free Republic
Browse · Search
News/Activism
Topics · Post Article


1 posted on 01/05/2017 4:59:29 AM PST by nuconvert
[ Post Reply | Private Reply | View Replies ]


Navigation: use the links below to view more comments.
first 1-2021-22 next last
To: nuconvert

Well, maybe some people should wake up to The Middle East while they’re at it.


2 posted on 01/05/2017 5:03:54 AM PST by Morpheus2009
[ Post Reply | Private Reply | To 1 | View Replies ]

To: nuconvert

I take everything the WaPest writes, invert it 180 degrees, and realize THAT is the truth.


3 posted on 01/05/2017 5:07:53 AM PST by Lazamataz (TRUMP LIED TO ME!!!! ....He said I'd get sick of winning.... AND I'M NOT SICK OF WINNING YET!!!!)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: nuconvert

As I recall, the adoption ban was the direct result of an especially awful case of abuse perpetrated by a couple of gay guys who were celebrated in the mainstream media as exemplars of the New Family.


4 posted on 01/05/2017 5:08:16 AM PST by madprof98
[ Post Reply | Private Reply | To 1 | View Replies ]

To: nuconvert

Here's Mike Pence, from the first VP debate on Oct 5, 2016, on the subject of Putin and Russia:

“When Donald Trump and I observe that, as I’ve said, in Syria, in Iran, in Ukraine, that the small and bullying leader of Russia has been stronger on the world stage than this administration, that’s stating painful facts. That’s not an endorsement of Vladimir Putin — that’s an indictment of the weak and feckless leadership of Hillary Clinton and Barack Obama.”

______________________________

Also from the Oct 5, 2016 first VP debate...

QUIJANO (Moderator): I want to turn now to Syria. Two hundred fifty thousand people, 100,000 of them children, are under siege in Aleppo, Syria. Bunker buster bombs, cluster munitions, and incendiary weapons are being dropped on them by Russian and Syrian militaries. Does the U.S. have a responsibility to protect civilians and prevent mass casualties on this scale, Governor Pence?

PENCE: The United States of America needs to begin to exercise strong leadership to protect the vulnerable citizens and over 100,000 children in Aleppo. Hillary Clinton’s top priority when she became secretary of state was the Russian reset, the Russians reset. After the Russian reset, the Russians invaded Ukraine and took over Crimea.

And the small and bullying leader of Russia is now dictating terms to the United States to the point where all the United States of America — the greatest nation on Earth — just withdraws from talks about a cease-fire while Vladimir Putin puts a missile defense system in Syria while he marshals the forces and begins — look, we have got to begin to lean into this with strong, broad-shouldered American leadership.

It begins by rebuilding our military. And the Russians and the Chinese have been making enormous investments in the military. We have the smallest Navy since 1916. We have the lowest number of troops since the end of the Second World War. We’ve got to work with Congress, and Donald Trump will, to rebuild our military and project American strength in the world.

But about Aleppo and about Syria, I truly do believe that what America ought to do right now is immediately establish safe zones, so that families and vulnerable families with children can move out of those areas, work with our Arab partners, real time, right now, to make that happen.

And secondly, I just have to tell you that the provocations by Russia need to be met with American strength. And if Russia chooses to be involved and continue, I should say, to be involved in this barbaric attack on civilians in Aleppo, the United States of America should be prepared to use military force to strike military targets of the Assad regime to prevent them from this humanitarian crisis that is taking place in Aleppo.

There’s a broad range of other things that we ought to do, as well. We ought to deploy a missile defense shield to the Czech Republic and Poland which Hillary Clinton and Barack Obama pulled back on out of not wanting to offend the Russians back in 2009.

QUIJANO: Governor, your two minutes are up.

PENCE: We’ve just got to have American strength on the world stage. When Donald Trump becomes president of the United States, the Russians and other countries in the world will know they’re dealing with a strong American president.

http://www.nytimes.com/2016/10/06/us/politics/vice-president-transcript.html

______________________________

And...

PENCE: What we’re dealing with is the — you know, there’s an old proverb that says the Russian bear never dies, it just hibernates.

And the truth of the matter is, the weak and feckless foreign policy of Hillary Clinton and Barack Obama has awakened an aggression in Russia that first appeared a few years ago with their move in Georgia, now their move into Crimea, now their move into the wider Middle East.

And all the while, all we do is fold our arms and say we’re not having talks anymore.

To answer your question, we just need American strength. We need to — we need to marshal the resources of our allies in the region, and in the immediate, we need to act and act now to get people out of harm’s way.

5 posted on 01/05/2017 5:12:04 AM PST by ETL (On the road to America's recovery!)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: nuconvert

Senator Jeff Sessions on Putin...

March 26, 2015

Interview with Jeff Sessions: U.S. and Europe "Have to Unify" Against Russia

excerpt...

What do you expect next from Russia?

Sessions: Well, there's a danger that they may continue this overreach. They just solidified power in Georgia, in South Ossetia. That was I think in the last week. Pressure is still on Ukraine. We don't know whether the Minsk Agreement will hold, I don't think it's holding very well now.

We have the Estonians, the Lithuanians, the Romanians, they're very worried. This is reality, I wish it weren't, but I'm afraid it is. It needs to be clear that Russia knows that there will be a high price to pay if this behavior continues.

If Minsk breaks down, at what point does the president have to act and supply Ukraine with lethal weaponry? What is the breaking point? We know from what Victoria Nuland said that the administration hasn't decided yet.

Sessions: From what I understand from this conference, I think it's clear that Germany has said publicly that they will support harsher sanctions and more military support if the Minsk Agreement fails. And that will be key.

Merkel has worked very very hard to establish a relationship with Putin and Russia. It's been a good-faith effort. If it fails, I would hope that Europe and the United States would have to unify and push back more firmly against Russian overreach. ..."

http://www.realclearworld.com/blog/2015/03/interview_with_jeff_sessions_us_and_europe_have_to_unify_against_russia_111076.html

or,

https://web.archive.org/web/20150709024356/http://www.realclearworld.com/blog/2015/03/interview_with_jeff_sessions_us_and_europe_have_to_unify_against_russia_111076.html

7 posted on 01/05/2017 5:12:58 AM PST by ETL (On the road to America's recovery!)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: nuconvert

Sessions has also pointed to Russia’s record as justification for a robust missile defense system, which has deep roots in north Alabama.

“Russia’s recent actions in Georgia remind us that country, which we once hoped was on a path to greater integration into the global world community, might again be seeking to restore old Soviet ideas of dominance throughout their neighbors and in Eastern Europe, all of which should serve as a motivation to move ahead with the necessary capabilities to defend ourselves and our allies from missile attack, in particular,” Sessions said on the Senate floor in 2008.

Two years later, Sessions voted against the New START nuclear arms reduction treaty with Russia, in part because he thought Obama conceded too much ground to the Russians.

http://www.usatoday.com/story/news/politics/elections/2016/08/15/sen-jeff-sessions-backs-donald-trump-russia-policy/88796584/

or,

https://web.archive.org/web/20161115103421/http://www.usatoday.com/story/news/politics/elections/2016/08/15/sen-jeff-sessions-backs-donald-trump-russia-policy/88796584/

8 posted on 01/05/2017 5:14:39 AM PST by ETL (On the road to America's recovery!)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: nuconvert

Donald Trump: 'Putin has eaten Obama's lunch' on Ukraine

Mar 13, 2014
Eun Kyung Kim: TODAY

Donald Trump slammed President Obama Thursday on TODAY for failing to take a stronger line against President Vladimir Putin in dealing with Ukraine, saying he feared Obama would now make up for lost time with imprudent moves to "show his manhood."

The real estate mogul and reality-TV star, who has criticized Putin for sending military troops into Crimea, said Obama must now take fierce steps to prevent the situation from escalating further.

"We should definitely do sanctions and we have to show some strengths. I mean, Putin has eaten Obama's lunch, therefore our lunch, for a long period of time," Trump said. ..."

http://www.today.com/news/donald-trump-putin-has-eaten-obamas-lunch-ukraine-2D79372098

9 posted on 01/05/2017 5:15:16 AM PST by ETL (On the road to America's recovery!)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: nuconvert
Sounds like he's projecting from 0bama onto Putin.

10 posted on 01/05/2017 5:16:09 AM PST by BitWielder1 (I'd rather have Unequal Wealth than Equal Poverty.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: nuconvert

So the U.S. doesn’t have a problem with MSM propaganda, with the perv podestas spirit cooking their way to power or the corrupt clintons stealing elections from Bernie and his reprobates or demonic fly-infested obama surrendering the nation over to outside invaders and supporting ISIS terrorism at every turn causing the middle east to burn into a ruinous heap all the while betraying longstanding allies at any opportunity,

Its now Putin because it cant still be George Bush’s fault,


12 posted on 01/05/2017 5:19:45 AM PST by captmar-vell
[ Post Reply | Private Reply | To 1 | View Replies ]

To: nuconvert; ETL; TigerLikesRooster
Vladimir Putin's Newest Export: Terrorists
ISIS is full of Russian speakers from Chechnya and other Caucasus republics, and the “stans.” One is suspected of the NYE shooting in Istanbul.
http://www.thedailybeast.com/articles/2017/01/04/vladimir-putin-s-newest-export-terrorists.html
14 posted on 01/05/2017 5:22:35 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: nuconvert

The US had had a problem with leadership. Obama/Hilary/Kerry have failed miserably with Russia, Putin, and pretty much everyone and everywhere else.


17 posted on 01/05/2017 5:28:27 AM PST by LostPassword
[ Post Reply | Private Reply | To 1 | View Replies ]

To: nuconvert

Americans have a problem with criminals, conmen, collectivists, Clintons, progressives, punks, socialists, scumbags, tyrants, totalitarians. Wake up world. Create your own destiny.

Here’s a start...

http://www.ushistory.org/declaration/document/

list your grievances.


22 posted on 01/05/2017 5:41:39 AM PST by PGalt (CONGRATULATIONS Donald J. Trump)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: nuconvert

The hatred of Russia is motivated by the love of the political elites of the Uniparty-(Republicans and Democrats) for Saudi Arabia.

The Arab Spring juggernaut of the Saudis and all it has wrought was foiled by Russian support of the Syrian government.

The recent military victory of the Russian backed side over the Saudi backed side in Aleppo set the stage for the sanctions on Russia more than anything else.

The “hacking” accusation with its implication of Russia helping Trump win the election is something any and all Republicans should repudiate.

I would ask Pence and Sessions and others mentioned in previous posts on this thread if they believe Russia hacked the election to help Donald Trump, “Yes” or “No”.


32 posted on 01/05/2017 5:54:42 AM PST by Nextrush (Freedom is everybody's business: Remember Pastor Niemoller)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: nuconvert

America has a problem with rhe Washington ComPost.


38 posted on 01/05/2017 6:00:18 AM PST by Daniel Ramsey (MAGA)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: nuconvert

Putin is only doing what is in the interest of Russia. It’s time the US had a president that did the same.


39 posted on 01/05/2017 6:00:29 AM PST by HarleyD
[ Post Reply | Private Reply | To 1 | View Replies ]

To: nuconvert

Our .gov always needs a boogie-man or a bad guy to hate and focus on ,, and most people agree with them .. .
imho


43 posted on 01/05/2017 6:10:30 AM PST by ßuddaßudd (>> F U B O << "What the hell kind of country is this if I can only hate a man if he's white?")
[ Post Reply | Private Reply | To 1 | View Replies ]

To: nuconvert

Just like Israel doesn’t have a problem with the USA...but with Obama (and the “tradition!” Jews that voted for him.)


44 posted on 01/05/2017 6:10:38 AM PST by ThePatriotsFlag ( Anything FREELY-GIVEN by the government was TAKEN from someone else.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: nuconvert

Folks,

It’s ok to believe that Russia had no part in hacking the DNC and Podesta and still believe that Putin is a dictator who is threatening eastern and central Europe and must be stopped in the Ukraine and Syria. These are not mutually exclusive ideas.

Garry Kasparov is correct when he states that Putin is a brutal dictator and he is not our friend. That doesn’t mean we can’t work with him to find a resolution in Syria and the Ukraine, but we must do it from a position of strength (rebuild of military) and let him know in no uncertain terms that the days of the Obama feckless and naïve foreign policy are over.


45 posted on 01/05/2017 6:13:45 AM PST by Old Teufel Hunden
[ Post Reply | Private Reply | To 1 | View Replies ]

To: nuconvert

Bird cage liner newspaper.


46 posted on 01/05/2017 6:18:16 AM PST by Quickgun (I got here kicking,screaming and covered in someone else's blood. I can go out that way if I have to)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: nuconvert

Look, Kasparov. We don’t need phony journalists like you to tell us who the U.S. does and does not have a problem with. We will wait for our new President to tell us that. Now go crawl back under your rock like the good little Leftist snake that you obviously are.


47 posted on 01/05/2017 6:19:06 AM PST by fortes fortuna juvat (God, Guns, and Trump will save the USA)
[ Post Reply | Private Reply | To 1 | View Replies ]


Navigation: use the links below to view more comments.
first 1-2021-22 next last

Free Republic
Browse · Search
News/Activism
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson