Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

The U.S. doesn’t have a problem with Russia. It has a problem with Vladimir Putin.
Washington Post ^ | Jan. 3, 2017 | Garry Kasparov

Posted on 01/05/2017 4:59:29 AM PST by nuconvert

-excerpt-

There is no consideration of what is or is not good for Russia, or for Russians, only what is best for him and his close circle of oligarch elites. The 2012 U.S. adoption of the Magnitsky Act, targeting Russian officials tied to criminal repression, was answered by banning the adoption of Russian orphans by Americans. Western sanctions over Putin’s illegal annexation of Crimea were met by boycotting many foreign goods, harming Russian businesses and consumers — to the perverse point of physically destroying thousands of tons of smuggled food in a country where many millions are battling hunger and poverty. Putin’s strategy is to get Russians to blame the free world by further punishing Russians himself. This can be countered only by being for Russia, but against Putin.


TOPICS: Editorial; Foreign Affairs; News/Current Events
KEYWORDS: 0problemsactually; americasproblem; garrykasparov; kgbputinfanclub; putin; putinistas; russia; usalliesproblem
Navigation: use the links below to view more comments.
first 1-2021-4041-6061-79 next last

1 posted on 01/05/2017 4:59:29 AM PST by nuconvert
[ Post Reply | Private Reply | View Replies]

To: nuconvert

Well, maybe some people should wake up to The Middle East while they’re at it.


2 posted on 01/05/2017 5:03:54 AM PST by Morpheus2009
[ Post Reply | Private Reply | To 1 | View Replies]

To: nuconvert

I take everything the WaPest writes, invert it 180 degrees, and realize THAT is the truth.


3 posted on 01/05/2017 5:07:53 AM PST by Lazamataz (TRUMP LIED TO ME!!!! ....He said I'd get sick of winning.... AND I'M NOT SICK OF WINNING YET!!!!)
[ Post Reply | Private Reply | To 1 | View Replies]

To: nuconvert

As I recall, the adoption ban was the direct result of an especially awful case of abuse perpetrated by a couple of gay guys who were celebrated in the mainstream media as exemplars of the New Family.


4 posted on 01/05/2017 5:08:16 AM PST by madprof98
[ Post Reply | Private Reply | To 1 | View Replies]

To: nuconvert

Here's Mike Pence, from the first VP debate on Oct 5, 2016, on the subject of Putin and Russia:

“When Donald Trump and I observe that, as I’ve said, in Syria, in Iran, in Ukraine, that the small and bullying leader of Russia has been stronger on the world stage than this administration, that’s stating painful facts. That’s not an endorsement of Vladimir Putin — that’s an indictment of the weak and feckless leadership of Hillary Clinton and Barack Obama.”

______________________________

Also from the Oct 5, 2016 first VP debate...

QUIJANO (Moderator): I want to turn now to Syria. Two hundred fifty thousand people, 100,000 of them children, are under siege in Aleppo, Syria. Bunker buster bombs, cluster munitions, and incendiary weapons are being dropped on them by Russian and Syrian militaries. Does the U.S. have a responsibility to protect civilians and prevent mass casualties on this scale, Governor Pence?

PENCE: The United States of America needs to begin to exercise strong leadership to protect the vulnerable citizens and over 100,000 children in Aleppo. Hillary Clinton’s top priority when she became secretary of state was the Russian reset, the Russians reset. After the Russian reset, the Russians invaded Ukraine and took over Crimea.

And the small and bullying leader of Russia is now dictating terms to the United States to the point where all the United States of America — the greatest nation on Earth — just withdraws from talks about a cease-fire while Vladimir Putin puts a missile defense system in Syria while he marshals the forces and begins — look, we have got to begin to lean into this with strong, broad-shouldered American leadership.

It begins by rebuilding our military. And the Russians and the Chinese have been making enormous investments in the military. We have the smallest Navy since 1916. We have the lowest number of troops since the end of the Second World War. We’ve got to work with Congress, and Donald Trump will, to rebuild our military and project American strength in the world.

But about Aleppo and about Syria, I truly do believe that what America ought to do right now is immediately establish safe zones, so that families and vulnerable families with children can move out of those areas, work with our Arab partners, real time, right now, to make that happen.

And secondly, I just have to tell you that the provocations by Russia need to be met with American strength. And if Russia chooses to be involved and continue, I should say, to be involved in this barbaric attack on civilians in Aleppo, the United States of America should be prepared to use military force to strike military targets of the Assad regime to prevent them from this humanitarian crisis that is taking place in Aleppo.

There’s a broad range of other things that we ought to do, as well. We ought to deploy a missile defense shield to the Czech Republic and Poland which Hillary Clinton and Barack Obama pulled back on out of not wanting to offend the Russians back in 2009.

QUIJANO: Governor, your two minutes are up.

PENCE: We’ve just got to have American strength on the world stage. When Donald Trump becomes president of the United States, the Russians and other countries in the world will know they’re dealing with a strong American president.

http://www.nytimes.com/2016/10/06/us/politics/vice-president-transcript.html

______________________________

And...

PENCE: What we’re dealing with is the — you know, there’s an old proverb that says the Russian bear never dies, it just hibernates.

And the truth of the matter is, the weak and feckless foreign policy of Hillary Clinton and Barack Obama has awakened an aggression in Russia that first appeared a few years ago with their move in Georgia, now their move into Crimea, now their move into the wider Middle East.

And all the while, all we do is fold our arms and say we’re not having talks anymore.

To answer your question, we just need American strength. We need to — we need to marshal the resources of our allies in the region, and in the immediate, we need to act and act now to get people out of harm’s way.

5 posted on 01/05/2017 5:12:04 AM PST by ETL (On the road to America's recovery!)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Lazamataz

I normally would agree with you 100%, however take at look at the author...He’s no WaPo stooge.

And I believe he could kick your a$$ in chess...


6 posted on 01/05/2017 5:12:21 AM PST by BBB333 (The power of TRUMP compels you!)
[ Post Reply | Private Reply | To 3 | View Replies]

To: nuconvert

Senator Jeff Sessions on Putin...

March 26, 2015

Interview with Jeff Sessions: U.S. and Europe "Have to Unify" Against Russia

excerpt...

What do you expect next from Russia?

Sessions: Well, there's a danger that they may continue this overreach. They just solidified power in Georgia, in South Ossetia. That was I think in the last week. Pressure is still on Ukraine. We don't know whether the Minsk Agreement will hold, I don't think it's holding very well now.

We have the Estonians, the Lithuanians, the Romanians, they're very worried. This is reality, I wish it weren't, but I'm afraid it is. It needs to be clear that Russia knows that there will be a high price to pay if this behavior continues.

If Minsk breaks down, at what point does the president have to act and supply Ukraine with lethal weaponry? What is the breaking point? We know from what Victoria Nuland said that the administration hasn't decided yet.

Sessions: From what I understand from this conference, I think it's clear that Germany has said publicly that they will support harsher sanctions and more military support if the Minsk Agreement fails. And that will be key.

Merkel has worked very very hard to establish a relationship with Putin and Russia. It's been a good-faith effort. If it fails, I would hope that Europe and the United States would have to unify and push back more firmly against Russian overreach. ..."

http://www.realclearworld.com/blog/2015/03/interview_with_jeff_sessions_us_and_europe_have_to_unify_against_russia_111076.html

or,

https://web.archive.org/web/20150709024356/http://www.realclearworld.com/blog/2015/03/interview_with_jeff_sessions_us_and_europe_have_to_unify_against_russia_111076.html

7 posted on 01/05/2017 5:12:58 AM PST by ETL (On the road to America's recovery!)
[ Post Reply | Private Reply | To 1 | View Replies]

To: nuconvert

Sessions has also pointed to Russia’s record as justification for a robust missile defense system, which has deep roots in north Alabama.

“Russia’s recent actions in Georgia remind us that country, which we once hoped was on a path to greater integration into the global world community, might again be seeking to restore old Soviet ideas of dominance throughout their neighbors and in Eastern Europe, all of which should serve as a motivation to move ahead with the necessary capabilities to defend ourselves and our allies from missile attack, in particular,” Sessions said on the Senate floor in 2008.

Two years later, Sessions voted against the New START nuclear arms reduction treaty with Russia, in part because he thought Obama conceded too much ground to the Russians.

http://www.usatoday.com/story/news/politics/elections/2016/08/15/sen-jeff-sessions-backs-donald-trump-russia-policy/88796584/

or,

https://web.archive.org/web/20161115103421/http://www.usatoday.com/story/news/politics/elections/2016/08/15/sen-jeff-sessions-backs-donald-trump-russia-policy/88796584/

8 posted on 01/05/2017 5:14:39 AM PST by ETL (On the road to America's recovery!)
[ Post Reply | Private Reply | To 1 | View Replies]

To: nuconvert

Donald Trump: 'Putin has eaten Obama's lunch' on Ukraine

Mar 13, 2014
Eun Kyung Kim: TODAY

Donald Trump slammed President Obama Thursday on TODAY for failing to take a stronger line against President Vladimir Putin in dealing with Ukraine, saying he feared Obama would now make up for lost time with imprudent moves to "show his manhood."

The real estate mogul and reality-TV star, who has criticized Putin for sending military troops into Crimea, said Obama must now take fierce steps to prevent the situation from escalating further.

"We should definitely do sanctions and we have to show some strengths. I mean, Putin has eaten Obama's lunch, therefore our lunch, for a long period of time," Trump said. ..."

http://www.today.com/news/donald-trump-putin-has-eaten-obamas-lunch-ukraine-2D79372098

9 posted on 01/05/2017 5:15:16 AM PST by ETL (On the road to America's recovery!)
[ Post Reply | Private Reply | To 1 | View Replies]

To: nuconvert
Sounds like he's projecting from 0bama onto Putin.

10 posted on 01/05/2017 5:16:09 AM PST by BitWielder1 (I'd rather have Unequal Wealth than Equal Poverty.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Lazamataz
Not this time Laz. Kasparov has always hated Putin.
11 posted on 01/05/2017 5:18:07 AM PST by deadrock (I is someone else.)
[ Post Reply | Private Reply | To 3 | View Replies]

To: nuconvert

So the U.S. doesn’t have a problem with MSM propaganda, with the perv podestas spirit cooking their way to power or the corrupt clintons stealing elections from Bernie and his reprobates or demonic fly-infested obama surrendering the nation over to outside invaders and supporting ISIS terrorism at every turn causing the middle east to burn into a ruinous heap all the while betraying longstanding allies at any opportunity,

Its now Putin because it cant still be George Bush’s fault,


12 posted on 01/05/2017 5:19:45 AM PST by captmar-vell
[ Post Reply | Private Reply | To 1 | View Replies]

To: madprof98

As I recall, the adoption ban was the direct result of an especially awful case of abuse perpetrated by a couple of gay guys who were celebrated in the mainstream media as exemplars of the New Family.


Plenty of Russians drink dangerous alcohol substitutes. Does Putin ban them? No. Putin banned foreign adoptions because it was humiliating and likened Putinist Russia to 3rd world dump holes.


13 posted on 01/05/2017 5:20:14 AM PST by lodi90
[ Post Reply | Private Reply | To 4 | View Replies]

To: nuconvert; ETL; TigerLikesRooster
Vladimir Putin's Newest Export: Terrorists
ISIS is full of Russian speakers from Chechnya and other Caucasus republics, and the “stans.” One is suspected of the NYE shooting in Istanbul.
http://www.thedailybeast.com/articles/2017/01/04/vladimir-putin-s-newest-export-terrorists.html
14 posted on 01/05/2017 5:22:35 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Lazamataz
Agreed.

The U.S. doesn’t have a problem with Russia, nor does it have a problem with Vladimir Putin.

The elites who profit from war have the problem, and it is entirely their creation.

The attempted manipulation of public opinion, in this age of interwebs, is laughable.

15 posted on 01/05/2017 5:25:10 AM PST by T-Bone Texan
[ Post Reply | Private Reply | To 3 | View Replies]

To: Lazamataz

Wasn’t written by the WaPest - it was written by Garry Kasparov


16 posted on 01/05/2017 5:25:46 AM PST by nuconvert ( Khomeini promised change too // Hail, Chairman O)
[ Post Reply | Private Reply | To 3 | View Replies]

To: nuconvert

The US had had a problem with leadership. Obama/Hilary/Kerry have failed miserably with Russia, Putin, and pretty much everyone and everywhere else.


17 posted on 01/05/2017 5:28:27 AM PST by LostPassword
[ Post Reply | Private Reply | To 1 | View Replies]

To: LostPassword

Can’t argue with that!


18 posted on 01/05/2017 5:30:18 AM PST by nuconvert ( Khomeini promised change too // Hail, Chairman O)
[ Post Reply | Private Reply | To 17 | View Replies]

To: AdmSmith

It drives me nuts when I hear people who should know better, talking about Putin fighting along side of us against terrorism - And that’s our common goal. BALONEY.
The only terrorism/terrorists that Putin cares about, are the ones in his country, or the ones getting in the way of his plans.


19 posted on 01/05/2017 5:35:50 AM PST by nuconvert ( Khomeini promised change too // Hail, Chairman O)
[ Post Reply | Private Reply | To 14 | View Replies]

To: deadrock

KGB Putin has been playing people on BOTH sides for absolutely fools. As a long-time KGB and later head of its modern equivalent, the FSB, he is a grand master of deception. The Russians, in general, play chess, thinking many moves ahead of their opponents, while most of us, sadly, suck at simple checkers, and can’t begin to grasp the degree of treachery and deception they engage in.


20 posted on 01/05/2017 5:36:26 AM PST by ETL (On the road to America's recovery!)
[ Post Reply | Private Reply | To 11 | View Replies]


Navigation: use the links below to view more comments.
first 1-2021-4041-6061-79 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson