Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

Putin’s War of Words with Turkey Escalates to Nukes and Ethnic Cleansing
FT.Com ^ | 10 hours ago | By Rob Garver

Posted on 12/10/2015 1:01:25 AM PST by SaveFerris

click here to read article


Navigation: use the links below to view more comments.
first 1-2021-25 next last
Well, FWIW
1 posted on 12/10/2015 1:01:25 AM PST by SaveFerris
[ Post Reply | Private Reply | View Replies]

To: RushIsMyTeddyBear; metmom; CynicalBear; SkyPilot; tuffydoodle; tang-soo; righttackle44; ...

ping


2 posted on 12/10/2015 1:02:06 AM PST by SaveFerris (Be a blessing to a stranger today for some have entertained angels unaware)
[ Post Reply | Private Reply | To 1 | View Replies]

To: SaveFerris
From the campaign trail, 2008...

Obama Pledges Cuts in Missile Defense, Space, and Nuclear Weapons Programs

February 29, 2008 :: News
MissileThreat.com

A video has surfaced of Presidential candidate Senator Barack Obama talking on his plans for strategic issues such as nuclear weapons and missile defense.

The full text from the video, as released, reads as follows:

Thanks so much for the Caucus4Priorities, for the great work you've been doing. As president, I will end misguided defense policies and stand with Caucus4Priorities in fighting special interests in Washington.

First, I'll stop spending $9 billion a month in Iraq. I'm the only major candidate who opposed this war from the beginning. And as president I will end it.[i.e. not win it]

Second, I will cut tens of billions of dollars in wasteful spending.

I will cut investments in unproven missile defense systems.

I will not weaponize space.

I will slow our development of future combat systems.

And I will institute an independent "Defense Priorities Board" to ensure that the Quadrennial Defense Review is not used to justify unnecessary spending.

Third, I will set a goal of a world without nuclear weapons. To seek that goal, I will not develop new nuclear weapons; I will seek a global ban on the production of fissile material; and I will negotiate with Russia to take our ICBMs off hair-trigger alert, and to achieve deep cuts in our nuclear arsenals.

You know where I stand. I've fought for open, ethical and accountable government my entire public life. I don't switch positions or make promises that can't be kept. I don't posture on defense policy and I don't take money from federal lobbyists for powerful defense contractors. As president, my sole priority for defense spending will be protecting the American people. Thanks so much.

Article: Obama Pledges Cuts in Missile Defense, Space, and Nuclear Weapons Programs:

http://web.archive.org/web/20090412030633/http://missilethreat.com/archives/id.7086/detail.asp

"MissileThreat.com is a project of The Claremont Institute devoted to understanding and promoting the requirements for the strategic defense of the United States."
___________________________________________________

March 2012...

"Obama was talking with Russian President Dmitry Medvedev when neither of them realized that their conversation was being picked up by microphones. Here is what they said:

Obama: "On all these issues, but particularly missile defense, this, this can be solved, but it's important for him to give me space."

Medvedev: "Yeah, I understand. I understand your message about space. Space for you ..."

Obama: "This is my last election. After my election, I have more flexibility."

Medvedev: "I understand. I will transmit this information to Vladimir."

"This is my last election. After my election I have more flexibility." That statement tells us much about the president's mindset.

The specific mention of missile defense is worrisome enough. Mr. Obama has retreated from the missile defense plan that was negotiated with European allies during the George W. Bush administration. Apparently, he is signaling Moscow that he intends to retreat further. The clear implication from the president's comments is that he cannot tell the American people before the election what he plans to do after the election.

In addition, there is the phrase "on all these issues," implying more is at stake than just missile defense."

Article: Obama plans double cross on missile defense
When it comes to keeping America safe, we shouldn't be too flexible:
http://www.washingtontimes.com/news/2012/mar/29/obama-plans-double-cross-on-missile-defense/print/
__________________________________________________________

Image and video hosting by TinyPic


3 posted on 12/10/2015 1:23:10 AM PST by ETL (Ted Cruz 2016!! -- For a better, safer America)
[ Post Reply | Private Reply | To 1 | View Replies]

To: SaveFerris
Ted Cruz on ISIS, Russia, Obama, missile defense, and the New START Treaty with Russia...

"If we want to actually dismantle ISIS, we need to dramatically change course. We need a real, robust campaign that maximizes our overwhelming air advantage.

We need to focus our efforts not on trying to create friends, but on supporting our real ones, especially the Kurds in Iraq and Syria who have actually had success against ISIS."

-snip-

"We can redouble our efforts to develop the defensive weapons that neutralized the offensive Soviet threat -- particularly missile defense, which has seen a 25% budget reduction under Obama, according to an analysis from the conservative Heritage Foundation, and has been constrained by bad arms deals like New START.

We should not only move quickly to install the canceled interceptor sites Putin opposed in Poland and the Czech Republic, but also to develop the next generation of systems that will only increase his discomfiture.

These options do not entail a ground war in Syria, yet would effectively shake us free from the failed policies that have brought us to our current impasse.

These options set us on a new path that puts Putin on notice that the United States is reclaiming our traditional role as leader of the free world."

http://www.cnn.com/2015/10/09/opinions/cruz-syria-putin/index.html

**********************************************************

"I think it would be a mistake to get involved in the Syrian civil war. There have been voices in Washington eager for us to send our sons and daughters over to fight that civil war for some time. I haven't been one of them. I think the touchstone of U.S. military policy should be protecting the national security of this country."

"What we're seeing Putin in Russia do is a direct response to the profound weakness of Obama over six and a half years.

Putin views Obama as weak, as ineffective, and frankly, as a laughingstock. And, as a result, he is moving in, he is invading his neighbors, like Ukraine, he's kidnapping Estonians, and he's moving into Syria to gain a stronger foothold in the Middle East."

https://www.tedcruz.org/news/icymi-cruz-we-have-no-business-getting-in-the-middle-of-the-syrian-civil-war-goal-should-be-to-defeat-isis/

**********************************************************

Ted Cruz:
"We need a coherent plan to address both the specific crisis in Syria and the challenge posed more broadly by Putin's resurgent Russia.

The good news is that America still has options, if our leaders can summon the will to exercise them.

For starters, in Syria we can't double down on the failed strategies that have given Putin his opportunity to intervene.

We are now two years out from President Obama's proposed intervention after al-Assad used chemical weapons against his own people. ..."

http://www.cnn.com/2015/10/09/opinions/cruz-syria-putin/index.html

**********************************************************

"According to the Washington Free Beacon, Russia's nuclear arsenal how has over 100 nuclear warheads above the limit set by the treaty.

Since the treaty was launched, Russia has deployed 111 new nuclear warheads, bringing its total number of deployed warheads to 1,648. That treaty limit is 1,550 warheads - a number that must be reached in 2018.

Comparatively, the numbers of U.S. nuclear warheads, missiles and bombers have fallen dramatically and are already below the limits set by the treaty. Additionally, the United States has decreased the number of warheads in its deployed nuclear arsenal by 250.

While the United States intends to eliminate heavy bombers and launchers, Russia has launched a strategic nuclear force expansion.

Russian President Vladimir Putin also recently announced a new doctrine that placed priority on nuclear forces.

If this raises concern for you, you are not alone.

Rep. Mike Rogers, R-Ala., chairman of the House Armed Services Subcommittee on Strategic Forces, said Russia "is in the business of violating treaties."

Rogers said Putin has violated several agreements and treaties in the past, and he simply "violates any treaty or agreement that puts limits on capabilities that Mr. Putin and his cronies desire."

"Russia's arguable adherence to the New START Treaty just indicates how bad a deal it is for the United States," he said.

Adm. William Gortney, commander of the U.S. Northern Command, said Wednesday that Russia has read our play book and is "fielding cruise missiles that are very, very accurate, very long range."

Gortney said these missiles have the ability to reach targets in Canada and the United States. He added that Russia has been participating in war game scenarios recently that simulate cruise missile strikes in Alaska.

This news is serious because it appears Russia has no intention of abiding by New START or any other treaty. We should therefore be building up our military and our arsenals instead of depleting them.

source:
http://theminorityreportblog.com/2015/10/11/red-alert-russia-just-did-this-to-its-nuclear-arsenal-and-it-should-put-us-on-high-alert/?utm_source=dlvr.it&utm_medium=twitter

========================================================

From the FreeBeacon:

Russia Adds 111 Warheads Under Arms Treaty
Moscow warheads above New START treaty limit

By: Bill Gertz
October 9, 2015

Russia has now deployed more than 100 nuclear warheads in its strategic arsenal above the limits set by the New START arms treaty limits, two years before it must meet treaty arms reduction goals.

"New START nuclear warhead and delivery system numbers made public Oct. 1 reveal that since the 2010 arms accord went into force, Moscow increased the number of deployed nuclear warheads by a total of 111 weapons for a total of 1,648 deployed warheads. That number is 98 warheads above the treaty limit of 1,550 warheads that must be reached by the 2018 deadline of the treaty.

At the same time, U.S. nuclear warheads, missiles, and bombers have fallen sharply and remain below the required levels under the New START pact.

The United States during the same period of the Russian increases cut its deployed nuclear arsenal by 250 warheads. ..."

(more...)

http://freebeacon.com/national-security/russia-adds-111-warheads-under-arms-treaty/

4 posted on 12/10/2015 1:24:08 AM PST by ETL (Ted Cruz 2016!! -- For a better, safer America)
[ Post Reply | Private Reply | To 1 | View Replies]

To: ETL

I like the way he said “open, ethical and accountable” with a straight face. Well, not really.


5 posted on 12/10/2015 1:25:14 AM PST by SaveFerris (Be a blessing to a stranger today for some have entertained angels unaware)
[ Post Reply | Private Reply | To 3 | View Replies]

To: SaveFerris
From Investor's Business Daily, Jan 2012:

Obama To Betray Missile Defense Secrets To Moscow
Investor's Business Daily ^ | January 9, 2012 | IBD staff

Appeasement: From ObamaCare to recess appointments, honoring the Constitution has not been an administration hallmark. But when it comes to betraying secrets to mollify the Russians, it becomes a document the president hides behind.

It was bad enough that the 2012 defense authorization bill signed by President Obama set America on a downward spiral of military mediocrity.

He also issued a signing statement, something he once opposed, saying that language in the bill aimed at protecting top-secret technical data on the U.S. Standard Missile-3 - linchpin of our missile defense - might impinge on his constitutional foreign-policy authority.

Section 1227 of the defense law prohibits spending any funds that would be used to give Russian officials access to sensitive missile-defense technology as part of a cooperation agreement without first sending Congress a report identifying the specific secrets, how they'd be used and steps to protect the data from compromise.

The president is required to certify that any technology shared will not be passed on to third parties such as China, North Korea or Iran, that the Russians will not use transferred secrets to develop countermeasures and that the Russians are reciprocating in sharing missile-defense technology. ..."

"In his signing statement, Obama said he would treat these legal restrictions as 'non-binding' and that 'my administration will also interpret and implement section 1244 (sic) in a manner that does not interfere with the president's constitutional authority to conduct foreign affairs and avoids the undue disclosure of sensitive diplomatic communications.'

Betraying our secrets is easy for a president who betrayed allies Poland and the Czech Republic to placate Moscow.

Poland was to host ground-based interceptors such as those we've deployed in California and Alaska, with missile-tracking radar deployed in the Czech Republic.

Obama pulled the plug when Moscow objected. Never mind, he said, we have a better approach: a four-phase plan that calls for using three versions of the Navy's Standard SM-3 interceptor missile that forms the backbone of its Aegis missile-defense system.

The fourth phase consists of a missile still on the drawing board scheduled for deployment by 2020, a version of the SM-3 called the Block IIB. It would intercept hostile missiles in the "early intercept" phase before an enemy missile could release its warheads and decoys. The Russians want the SM-3's secrets, and Obama appears to be willing to turn them over.

The president wants to save the New Start Treaty, which the Russians have threatened to abandon if we try to fully implement President Reagan's dream of defeating a nuclear missile attack.

Russia has unilaterally asserted that any qualitative or quantitative improvement in U.S. missile defenses would be grounds for withdrawal from the treaty.

Read More At Investor's Business Daily:
http://news.investors.com/ibd-editorials/010912-597158-obama-gives-russia-missile-defense-secrets.htm#ixzz3jXmMbVwY

6 posted on 12/10/2015 1:29:33 AM PST by ETL (Ted Cruz 2016!! -- For a better, safer America)
[ Post Reply | Private Reply | To 1 | View Replies]

To: ETL

There’s a real threat to national security. The SM-3 seems to be a fantastic weapon.


7 posted on 12/10/2015 1:30:59 AM PST by SaveFerris (Be a blessing to a stranger today for some have entertained angels unaware)
[ Post Reply | Private Reply | To 6 | View Replies]

To: ETL

Look at the product placement in that photo! French’s mustart and A-1 Steak sauce...Coke. Had to be planned.


8 posted on 12/10/2015 1:35:02 AM PST by Cowboy Bob (With Trump & Cruz, America can't lose!)
[ Post Reply | Private Reply | To 3 | View Replies]

To: SaveFerris

For those that keep an eye on prophecy in the Bible, re-read the burden of Damascus Isiah 17:1. Looking at current events seems to align with the fulfillment of this prophecy.


9 posted on 12/10/2015 2:10:49 AM PST by taxcontrol ( The GOPe treats the conservative base like slaves by taking their votes and refuses to pay)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Cowboy Bob

Why, because the labels are facing forward as in a television commercial? Or do you mean in terms of trying to send some sort of message?


10 posted on 12/10/2015 2:17:13 AM PST by ETL (Ted Cruz 2016!! -- For a better, safer America)
[ Post Reply | Private Reply | To 8 | View Replies]

To: taxcontrol

Yes, have always kept that in mind. Good note.


11 posted on 12/10/2015 2:17:16 AM PST by SaveFerris (Be a blessing to a stranger today for some have entertained angels unaware)
[ Post Reply | Private Reply | To 9 | View Replies]

To: ETL
#Putin asks Thorin Oakenshield if his gang the Company of Dwarves could liquidate #Turkey's president Gollum

https://twitter.com/Sputnik_Not/status/674251984661323781

12 posted on 12/10/2015 5:25:07 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10 | View Replies]

To: All

Turks think they can do whatever they want because they are in NATO. They made a big mistake thinking that America would back them up in a war they started with Russia. Hopefully Russia wipes them out and takes Constantinople


13 posted on 12/10/2015 5:26:50 AM PST by escapefromboston (manny ortez: mvp)
[ Post Reply | Private Reply | To 1 | View Replies]

To: escapefromboston

The Daily Vertical: Hey, Look At My Nukes!
Published 10 December 2015
The Daily Vertical is a video primer for Russia-watchers that appears Monday through Friday. Viewers can suggest topics via Twitter @PowerVertical or on the Power Vertical Facebook page.

http://www.rferl.org/media/video/daily-vertical-hey-look-at-my-nukes/27418772.html


14 posted on 12/10/2015 5:37:00 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 13 | View Replies]

To: SaveFerris

I’ve had enough. Time to re-establish Constantinople!


15 posted on 12/10/2015 5:40:02 AM PST by PGR88
[ Post Reply | Private Reply | To 1 | View Replies]

To: SaveFerris
A Trump and Putin conversation:

Putin: I may have to use nuclear weapons against ISIS.
Trump: Hey that was my idea to bomb the shite out of them.
Putin: Well you are not president of your country, I am.
Trump: Not yet.
Putin: We'll talk again then.

16 posted on 12/10/2015 5:44:42 AM PST by McGruff (I don't know if sand can glow in the dark, but we’re going to find out - Ted Cruz)
[ Post Reply | Private Reply | To 1 | View Replies]

To: SaveFerris

The nukes would be wasted on Turkey.

Better spent cauterizing the sources of the infection, mecca, medina, and that damnable well in qom.


17 posted on 12/10/2015 7:32:38 AM PST by null and void (muslims don't kill people, Climate Change kills people!)
[ Post Reply | Private Reply | To 1 | View Replies]

To: SunkenCiv; ETL
Putin is doing a Saudi (getting rid of homemade Islamist by helping them abroad)

http://freebeacon.com/national-security/moscows-connection-to-the-islamic-state/

18 posted on 12/11/2015 1:18:12 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 14 | View Replies]

To: McGruff
This will probably feel like a punch in the gut to a die-hard Putinista such as yourself.

Donald Trump: 'Putin has eaten Obama's lunch' on Ukraine


Mar 13, 2014
Eun Kyung Kim: TODAY

Donald Trump slammed President Obama Thursday on TODAY for failing to take a stronger line against President Vladimir Putin in dealing with Ukraine, saying he feared Obama would now make up for lost time with imprudent moves to "show his manhood."

The real estate mogul and reality-TV star, who has criticized Putin for sending military troops into Crimea, said Obama must now take fierce steps to prevent the situation from escalating further.

"We should definitely do sanctions and we have to show some strengths. I mean, Putin has eaten Obama's lunch, therefore our lunch, for a long period of time," Trump said. ..."

http://www.today.com/news/donald-trump-putin-has-eaten-obamas-lunch-ukraine-2D79372098

19 posted on 12/11/2015 3:45:53 AM PST by ETL (Ted Cruz 2016!! -- For a better, safer America)
[ Post Reply | Private Reply | To 16 | View Replies]

To: ETL; nuconvert; SunkenCiv

Second, it is obvious to almost everyone that “Russia is not interested in a victory over ISIS.” Moscow’s foreign policy at present is about confrontation with the West in general and the US in particular, and both Vladimir Putin and many Russian commentators have suggested that the US and NATO not ISIS is Russia’s main enemy.

Stanislav Belkovsky, a Russian opposition political analyst, said that Putin “knew about the terrorist acts in Paris in advance because he has a broad network of agents in ISIS,” a network created and expanded by former KGB chief and Russian foreign minister Yevgeny Primakov. Vladimir Milov of Russia’s Democratic Choice Party has said the same.

And fourth, Russian and Soviet arms have turned up in ISIS. Russian propagandists say they came from Ukraine or somewhere else, but the leaders of the LNR and DNR would not be sending arms to anyone else without the direct approval of Moscow. That reality clearly suggests a Moscow connection.
http://windowoneurasia2.blogspot.de/2015/12/fsb-defectors-claims-about-moscows-ties.html?m=1


20 posted on 12/11/2015 8:00:33 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 18 | View Replies]


Navigation: use the links below to view more comments.
first 1-2021-25 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson