Free Republic
Browse · Search
News/Activism
Topics · Post Article

To: escapefromboston

The Daily Vertical: Hey, Look At My Nukes!
Published 10 December 2015
The Daily Vertical is a video primer for Russia-watchers that appears Monday through Friday. Viewers can suggest topics via Twitter @PowerVertical or on the Power Vertical Facebook page.

http://www.rferl.org/media/video/daily-vertical-hey-look-at-my-nukes/27418772.html


14 posted on 12/10/2015 5:37:00 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 13 | View Replies ]


To: SunkenCiv; ETL
Putin is doing a Saudi (getting rid of homemade Islamist by helping them abroad)

http://freebeacon.com/national-security/moscows-connection-to-the-islamic-state/

18 posted on 12/11/2015 1:18:12 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 14 | View Replies ]

Free Republic
Browse · Search
News/Activism
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson