Free Republic
Browse · Search
News/Activism
Topics · Post Article

To: All

Turks think they can do whatever they want because they are in NATO. They made a big mistake thinking that America would back them up in a war they started with Russia. Hopefully Russia wipes them out and takes Constantinople


13 posted on 12/10/2015 5:26:50 AM PST by escapefromboston (manny ortez: mvp)
[ Post Reply | Private Reply | To 1 | View Replies ]


To: escapefromboston

The Daily Vertical: Hey, Look At My Nukes!
Published 10 December 2015
The Daily Vertical is a video primer for Russia-watchers that appears Monday through Friday. Viewers can suggest topics via Twitter @PowerVertical or on the Power Vertical Facebook page.

http://www.rferl.org/media/video/daily-vertical-hey-look-at-my-nukes/27418772.html


14 posted on 12/10/2015 5:37:00 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 13 | View Replies ]

Free Republic
Browse · Search
News/Activism
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson