Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

Russian military showing capabilities no-one expected
9 News ( Australia) ^ | 10:17am October 30, 2015 | Brandon Livesay

Posted on 10/29/2015 7:37:20 PM PDT by Candor7

Russia has been flexing its military might in Syria and the sheer power and capability on display has left Western analysts shocked.

As Vladimir Putin ramps up attacks on ISIL, the true power the Russian president wields has become more apparent.

The latest video to emerge from the battlefields shows a mountain under fire from Russian flamethrower missiles known as the 'Blazing Sun'.

The explosion from these high-powered weapons triggers a wave of heat 1000°C which burns all of the oxygen nearby, leaving victims unable to breathe.

This war machine has been used by the Russian military for years, but some of its other recent attacks have never been witnessed.

October 21, 2015: Battles between Syrian regime forces and resistance groups were filmed using drones by Russian videographers in Damascus

When the Caspian Sea fleet got involved in the conflict, ships fired huge cruise missiles into the Middle-East which travelled about 1500km.

US analyst for Brookings Institution Garrett Campbell said this was a "previously unknown capability".

Mr Campbell said Russia's Buyan-M-class corvettes and Gepard-class frigates were smaller than the US equivalents - Freedom and Independence, "but they do not possess any cruise missiles or similar power projection capability".

The power of the Russian Navy was thought to be lacking only a year ago, but recent operations have given the West a lot to think about.

A Reuters report from May 27 last year claimed Russian ships were "more rust than ready".

But as recently as yesterday CNN reported Russian submarines were detected close to vital undersea cables near US waters.

Commander of US Naval Force Europe Admiral Mark Ferguson told an audience in Washington the Russian Navy had ramped up operations.

October 01, 2015: Russia’s defence ministry has released footage of the nation’s first round of airstrikes against ISIS targets in Syria.

"The proficiency and operational tempo of the Russian submarine force is increasing," he said.

"According to Russian Navy Chief Admiral Chirkov, the 'intensity' of Russian submarine patrols has risen by almost 50% over the last year."

The Russian Air Force has also flexed its muscles over Syria in recent weeks, flying up to 96 missions a day.

President Putin reportedly plans to increase this number to 300 a day, Russia Insider reports.

Mr Cambell said if Russia can maintain an air campaign of this level it would be an impressive feat.

"Almost none of our NATO allies could match what Russia has done so far in the skies," he said.


TOPICS: Editorial; Foreign Affairs; Russia; Syria; War on Terror
KEYWORDS: allahwahoowackbar; ordnance; russia; weaponry
Navigation: use the links below to view more comments.
first previous 1-2021-4041-6061-8081-82 next last
To: AdmSmith

I’ve been following the Russian campaign from day 1 and the BDA analysis posted by sideline analysts

There has been a deliberate and controlled application of air power on terrorist faction leadership with names of the dead islamo leadershio being announced daily mostly by the terros ( good shooting)

Also on terro training camps, weapons storage and key nodes that control major loc’s
And if course good old wiping out of anything that fires at Syrian army, Russians or Iranians... Now would islamis fire at Russian aircraft from mosques schools or even “ hospitals” ? You betcha. So who is responsible for the consequences ?

What there has not been is indiscriminate bombing of Civilians and civilian infrastructure. The Russian goal is for Assad to have a governable country. Unfortunately our goal and that ofour “ moderate rebel” allies is the opposite , which is what created 4 million refugees - not Assad

Targeting of individuals in key roles in the islamist factions such as commanders, bomb makers, and weapons experts seems to been greatly improved since Spetnaz entered the fight
Hmmm

If there were 12 “ field hospitals” hit then what have they been doing in areas controlled by islamist factions that have subjugated and terrorized Syrian civilians? Are there combatants fleeing to and hiding in “ field hospitals”? I am pretty sure the Russians have the coordinates of true humanitarian locations.

The only deliberate hospital bombing that has occurred this month was in Kunduz Afghanistan by US which is destroying evidence and not cooperating in a war crime investigation and the only deliberate destruction of civilian infrastructure in Syria that I have noted was the US taking out Aleppo’s 3 power stations leaving 2 million civilians in the dark


41 posted on 10/30/2015 3:04:53 AM PDT by silverleaf (Age takes a toll: Please have exact change)
[ Post Reply | Private Reply | To 40 | View Replies]

To: AdmSmith

I’ve been following the Russian campaign from day 1 and the BDA analysis posted by sideline analysts

There has been a deliberate and controlled application of air power on terrorist faction leadership with names of the dead islamo leadershio being announced daily mostly by the terros ( good shooting)

Also on terro training camps, weapons storage and key nodes that control major loc’s
And if course good old wiping out of anything that fires at Syrian army, Russians or Iranians... Now would islamis fire at Russian aircraft from mosques schools or even “ hospitals” ? You betcha. So who is responsible for the consequences ?

What there has not been is indiscriminate bombing of Civilians. The Russian goal us for Assad to have a governable country. Unfortunately our goal is the opposite

Targeting of individuals in key roles in the islamist factions such as commanders, bomb makers, and weapons experts seems to been greatly improved since Spetnaz entered the fight
Hmmm

If there were 12 “ field hospitals” hit then what have they been doing in areas controlled by islamist factions that have subjugated and terrorized Syrian civilians?

The only deliberate hospital bombing that has occurred this month was in Kunduz Afghanistan by US which is destroying evidence and not cooperating in a war crime investigation and the only deliberate destruction of civilian infrastructure in Syria that I have noted was the US taking out Aleppo’s 3 power stations leaving 2 million civilians in the dark


42 posted on 10/30/2015 3:05:54 AM PDT by silverleaf (Age takes a toll: Please have exact change)
[ Post Reply | Private Reply | To 40 | View Replies]

To: silverleaf
@silverleaf: The only deliberate hospital bombing that has occurred this month was in Kunduz Afghanistan.

Thus, you state that the bombing of the hospitals in Syria by Russia was not deliberate bombings. It means that it was mistakes, i.e. the Russian have lousy precision and intel. If that is the case then the Russians will convert Syria to rubbles, as they did in Grozny.
43 posted on 10/30/2015 3:19:02 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 42 | View Replies]

To: ClearCase_guy

Exactly.
You think russia is worried about collateral damage?
Shooting out of a mosque or hospital?
To hellwith ya, blow em up.


44 posted on 10/30/2015 3:23:22 AM PDT by Joe Boucher ( Obammy is a lie, a mooselimb and pond scum.)
[ Post Reply | Private Reply | To 2 | View Replies]

To: lavaroise

So what are the Putinists going to say now: >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>

They are going to laugh out loud and state that Russia does not wage politically correct warfare.

Putin has powned Obama since the bat-eared , little cocaine snorting tenderloin homo entered Putin’s presence during Saint Obama’s first attempted touchy feely,liberal leftist “reach out” back in July of 2009.

https://www.youtube.com/watch?v=VCT5qtVUWMk

Obama wanted to join hands with Putin and sing Cum-by-Ya and Putin has by NOW effectively chewed Obama’s arm off right to the shoulder and is continuing to allez en manger.What a glorious sight IMHO.


45 posted on 10/30/2015 3:27:10 AM PDT by Candor7 (Obama fascism article:(http://www.americanthinker.com/2009/05/barack_obama_the_quintessentia_1.html))
[ Post Reply | Private Reply | To 38 | View Replies]

To: Candor7
The Aging, Macho, B-List Celebs in Vladimir Putins Squad Funny stuff.


46 posted on 10/30/2015 3:38:35 AM PDT by Daffynition (*Gun control is a tool to make innocents pay the price for the guilty* W.LaPierre)
[ Post Reply | Private Reply | To 1 | View Replies]

To: AdmSmith

Not all of the idiots here cheering Russia on in their quest to basically take over the Middle East with all of its valuable resources and strategic military value are actual Putinistas. Many I suspect are simply small-minded and/or profoundly ignorant.


47 posted on 10/30/2015 3:50:19 AM PDT by ETL (Ted Cruz 2016!! -- For a better and safer America)
[ Post Reply | Private Reply | To 36 | View Replies]

To: AdmSmith
OSCE says spots deadly Russian rocket system in Ukraine for first time
Reuters, via Yahoo News ^ | Oct 2, 2015 | Anton Zverev

MOSCOW (Reuters) - International monitors say they have spotted a new kind of Russian weapons system in rebel-held Ukraine this week, possible evidence of Moscow's continued interest in Ukraine even as it focuses on Syria.

The Organization for Security and Co-operation in Europe, which is monitoring a ceasefire in eastern Ukraine, reported that its monitors had seen a mobile TOS-1 'Buratino' weapons system for the first time.

The Buratino is equipped with thermobaric warheads which spread a flammable liquid around a target and then ignite it. It can destroy several city blocks in one strike and cause indiscriminate damage.

Only Russia produces the system and it was not exported to Ukraine before the conflict broke out, according to IHS Jane's Group and the Stockholm International Peace Research Institute, which track arms exports.

The OSCE's findings are embarrassing for the Kremlin, which has turned down its rhetoric on Ukraine and shifted attention to Syria, where it has begun air strikes. The report comes before President Vladimir Putin holds talks in Paris on Friday with the leaders of Germany, France and Ukraine on the peace process.

(Excerpt) Read more at news.yahoo.com ...

48 posted on 10/30/2015 3:58:39 AM PDT by ETL (Ted Cruz 2016!! -- For a better and safer America)
[ Post Reply | Private Reply | To 36 | View Replies]

To: Daffynition

Damn! I always thought the guy on the right of that photo was a Cook, with some extraordinary culinary abilities...in the movies! :)


49 posted on 10/30/2015 4:06:27 AM PDT by odds
[ Post Reply | Private Reply | To 46 | View Replies]

To: babygene; Blueflag
Sounds like you are suggesting that the oxygen is just a catalyst. It isn’t so... As in the simplest case of hydrogen and oxygen, both elements are consumed to produce h2o. After the reaction, we neither have oxygen or hydrogen, just water.

Good example, and the standard nomenclature is that hydrogen is being burned, not oxygen. Hydrogen is the fuel, oxygen "the burn". Same in an engine. Fuel is burned, oxygen does it. No one calls it an oxygen engine.

50 posted on 10/30/2015 4:13:40 AM PDT by Moltke
[ Post Reply | Private Reply | To 26 | View Replies]

To: huldah1776
I bet we showed them, eh?

Well, if you've been reading FR for the past decade or so, the Russians are scared to death of NATO.

51 posted on 10/30/2015 4:21:14 AM PDT by 1rudeboy
[ Post Reply | Private Reply | To 27 | View Replies]

To: Daffynition

It would be funny except that Putin is giving these has been celebs shelter from the taxation and controls foisted upon them by liberal fascism ( Yes liberal fascism, read about it here: http://www.americanthinker.com/2009/05/barack_obama_the_quintessentia_1.html) and its extreme draconian taxation troughout Europe and the West. Putin is actually extending individual protection to people the way the USA used to do as a matter of course ( but not now though, taxes are too onerous.)The exodus of Capital via US citizen renunciation is no joke:

https://www.sovereignman.com/trends/americans-renouncing-us-citizenship-soars-to-yet-another-record-high-18134/


52 posted on 10/30/2015 4:21:32 AM PDT by Candor7 (Obama fascism article:(http://www.americanthinker.com/2009/05/barack_obama_the_quintessentia_1.html))
[ Post Reply | Private Reply | To 46 | View Replies]

To: 1rudeboy

The question is, are they now knowing that there won’t be any support from the US until 2017 January, LORD willing?

Got me wondering about what this administration has planned for next year.


53 posted on 10/30/2015 4:30:31 AM PDT by huldah1776
[ Post Reply | Private Reply | To 51 | View Replies]

To: Right Brother

Disclosure: I am a former firefighter, a LONG time ago. I also have a minor in chemistry from a loooooong time ago.

Those signs are posted because normal combustibles in the presence of an enhanced oxygen atmosphere can burn curiously and rapidly. For instance a lit cigarette will burn so rapidly it appear to explode. A struck match goes off like a small fire cracker. Cotton sheets and polyester shirts burn like they are soaked in kerosene.

But it’s the combustibles burning NOT the oxygen.

Oxygen is a reagent in the chemical process of “burning.” Oxygen itself CANNOT BURN.


54 posted on 10/30/2015 4:35:34 AM PDT by Blueflag (Res ipsa loquitur: non vehere est inermus)
[ Post Reply | Private Reply | To 23 | View Replies]

To: babygene

No. I know better than to suggest oxygen is a mere catalyst. A catalyst is unchanged in a reaction. Oxygen is a reagent in the “burn” process.

Just accept it. The fuel air bomb does not burn the oxygen.


55 posted on 10/30/2015 4:38:36 AM PDT by Blueflag (Res ipsa loquitur: non vehere est inermus)
[ Post Reply | Private Reply | To 26 | View Replies]

To: Blueflag

Curiously should read Furiously


56 posted on 10/30/2015 4:40:13 AM PDT by Blueflag (Res ipsa loquitur: non vehere est inermus)
[ Post Reply | Private Reply | To 54 | View Replies]

To: babygene

Baby gene - no.

Just no.


57 posted on 10/30/2015 4:46:39 AM PDT by Blueflag (Res ipsa loquitur: non vehere est inermus)
[ Post Reply | Private Reply | To 19 | View Replies]

To: Candor7
Russian military showing capabilities no-one expected

No one?

58 posted on 10/30/2015 4:51:41 AM PDT by Elsie (Heck is where people, who don't believe in Gosh, think they are not going...)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Moltke
Good example, and the standard nomenclature is that hydrogen is being burned, not oxygen. Hydrogen is the fuel, oxygen "the burn". Same in an engine. Fuel is burned, oxygen does it. No one calls it an oxygen engine.

Me and Chelsea were SHOT at in Bosnia!

59 posted on 10/30/2015 4:58:42 AM PDT by Elsie (Heck is where people, who don't believe in Gosh, think they are not going...)
[ Post Reply | Private Reply | To 50 | View Replies]

To: Blueflag

Oxygen and some type of hydrocarbon are combined in an exothermic reaction.

The end products are various oxides and heat.


60 posted on 10/30/2015 5:01:33 AM PDT by Elsie (Heck is where people, who don't believe in Gosh, think they are not going...)
[ Post Reply | Private Reply | To 55 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-2021-4041-6061-8081-82 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson