Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

Genome Study Points to Adaptation in Early African-Americans
NY Times ^ | January 2, 2012 | NICHOLAS WADE

Posted on 01/08/2012 2:22:04 PM PST by neverdem

Researchers scanning the genomes of African-Americans say they see evidence of natural selection as their ancestors adapted to the harsh conditions of their new environment in America.

The scientists, led by Li Jin of the Chinese Academy of Sciences in Shanghai, report in the journal Genome Research that certain disease-causing variant genes became more common in African-Americans after their ancestors reached American shores — perhaps because they conferred greater, offsetting benefits. Other gene variants have become less common, the researchers say, like the gene for sickle cell hemoglobin, which in its more common single-dose form protects against malaria. The Shanghai team suggests the gene has become less common in African-Americans because malaria is much less of a threat.

The purpose of studying African-American genomes is largely medical. Most searches for variant genes that cause disease take place in people of European ancestry, and physicians want to make sure they have not missed variants that may be more common in African-Americans and helpful for developing treatments or diagnosis.

Such searches often reveal events in a population’s history by pinpointing genes that have changed under the pressure of natural selection.

The unusually common variants identified by the Shanghai team are associated with higher risk of hypertension, prostate cancer, sclerosis and bladder cancer.

“Most of the genes associated with African-American ethnic diseases,” they write, “may have played an important role in African-Americans’ adaptation to local environment.” But the authors have not yet been able to identify the benefits they believe such genes conferred.

Mark D. Shriver, a geneticist at Penn State, said it was plausible that some versions of a gene would become more common as African-Americans adjusted to a new environment. “It’s very valid to expect that there will be factors subject to genetic adaptation and that are now more prevalent in...”

(Excerpt) Read more at nytimes.com ...


TOPICS: Culture/Society; News/Current Events; Testing
KEYWORDS: evolution; genetics; genomics; naturalselection
Navigation: use the links below to view more comments.
first 1-20, 21-25 next last
Genome-wide detection of natural selection in African Americans pre-and post-admixture

It is particularly meaningful to investigate natural selection in African Americans (AfA) due to the high mortality their African ancestry has experienced in history. In this study, we examined 491,526 autosomal SNPs genotyped in 5,210 individuals and conducted a genome-wide search for selection signals in 1,890 AfA. Several genomic regions showing excess of African or European ancestry, which were thought as the footprints of selection since population admixture, were detected based on a commonly used approach. However, we also developed a new strategy to detect natural selection both pre-and post-admixture by reconstructing an ancestral African population (AAF) from inferred African components of ancestry in AfA and comparing it with indigenous African populations (IAF). Interestingly, many selection-candidate genes identified by the new approach were associated with AfA specific high-risk diseases such as prostate cancer and hypertension, suggesting an important role these disease-related genes might have played in adapting to new environment. CD36 and HBB, whose mutations confer a degree of protection against malaria, were also located in the highly differentiated regions between AAF and IAF. Further analysis showed that the frequencies of alleles protecting against malaria in AAF were lower than that in IAF, which consists with the relaxed selection pressure of malaria in the New World. There is no overlap between the top candidate genes detected by the two approaches, indicating the different environmental pressures AfA experienced pre-and post-population-admixture. We suggest that the new approach is reasonably powerful and can also be applied to other admixed populations such as Latinos and Uyghurs.

Why did the Times post this story? It undermines the left's argument that increased minority morbidity and mortality is due to inferior medical care caused by conscious and unconscious bias by the evil white majority in the health care professions.
1 posted on 01/08/2012 2:22:10 PM PST by neverdem
[ Post Reply | Private Reply | View Replies]

To: neverdem

Ah jeez. Under 400 years and it shows up in the genome...color me skeptical.


2 posted on 01/08/2012 2:27:42 PM PST by gorush (History repeats itself because human nature is static)
[ Post Reply | Private Reply | To 1 | View Replies]

To: gorush

Ding! We have a winner!

This looks like the same sort of politically correct statement made in the pursuit of future grants that we also see in “scientific” articles that make gratuitous references to global warming. This whole thing seems completely specious. Look for problem genetics in the sub-population, fine. Attempting to attribute these problem genes to 400 years of Darwinism in a long-lived mammalian species? Horse apples.


3 posted on 01/08/2012 2:37:09 PM PST by FreedomPoster (Islam delenda est)
[ Post Reply | Private Reply | To 2 | View Replies]

To: neverdem

The false premise here is that early African-Americans as a group were free to “select” and reproduce. They weren’t. The resistance to malaria was not understood nor was malaria itself at the time, but the apparent disease resistance did lead to a preference for slaves who had that trait, in those climates that had problems with the same disease. It’s credited in no small part with the rise of the Trans-Atlantic slave trade in North America, versus the previous use of indentured servants who were largely from the British Isles. These individuals were affected very adversely, not just by disease but by heat and humidity.

The trait faded as it was diluted after the abolishment of slavery and the descendants of former slaves relocated elsewhere and actually did have the freedom to select and reproduce, that these researchers mistakenly attribute to a population that was restricted and bred much like any other chattel.

It’s an ugly truth, but truth it is. Playing pretend doesn’t change it.


4 posted on 01/08/2012 2:40:00 PM PST by RegulatorCountry
[ Post Reply | Private Reply | To 1 | View Replies]

To: neverdem

I have been receiving geonome information from a saliva sample I submitted over two years ago. The lab that is doing the study is wrong in so many instances I disregard their emails. Someone else paid the $400 for my participation in the program.The geonome science is not what it’s advertised to be. Grain of salt, tongue in cheek. Don’t draw any conclusions from this study source.


5 posted on 01/08/2012 3:01:18 PM PST by P3_Acoustic
[ Post Reply | Private Reply | To 1 | View Replies]

To: neverdem

I’m no scientist, but have several thoughts on this topic. Malaria was endemic in many parts of the American south up to the 1920’s so the lessening of the Sickle cell anemia just because they left Africa seems a wrong conclusion. Are the other increases in certain disease statistics among Blacks really due to the stress of slavery in America or, from too much soda pop and Popeye’s chicken bought with government entitlement checks?


6 posted on 01/08/2012 3:31:12 PM PST by RicocheT (Eat the rich only if you're certain it's your last meal)
[ Post Reply | Private Reply | To 1 | View Replies]

To: RegulatorCountry
The false premise here is that early African-Americans as a group were free to “select” and reproduce.

Actually many of the first the first African Americans were free. The race wasn't here in great numbers till the inception of slavery but many of the first were free. The earliest blacks in America were British citizens and were just as poor as the rest of the early colonists.

Incidentally the first known true slave owner in America was a back man named Anthony Johnson who himself arrived around 1620 as an indentured servant and managed to pay off his debts and gain his freedom by 1635.

Johnson then moved to Northhampton county Va. and bought a farm and acquired 5 more African indentured servants of his own. The indentured servants became true slaves after a fired destroyed the records of Johnson and the courts ruled that John Casor remain the servant of Johnson for life.

Wikipedia actually has a surprisingly fair write up on it.

Anthony Johnson (colonist)
7 posted on 01/08/2012 3:37:13 PM PST by cripplecreek (Stand with courage or shut up and do as you're told.)
[ Post Reply | Private Reply | To 4 | View Replies]

To: cripplecreek

If you look back through the archives of FR, you’ll discover that I posted about Anthony Johnson many years ago. He bought his own wife out of slavery. Her name was Juana or Juanita.

The qualifier “as a group” was intended to cover outliers who were themselves always free, or were indentured servants who worked out the term of their indenture, and in the case of Mr. Johnson, became a slave owner himself.
Bondage was clearly not viewed in the light that we view it, at that time.

The Trans-Atlantic slave trade did rise in part because of disease resistance. Indentured servants from the British Isles, primarily Irish, died too quickly to be of much benefit to the rice and indigo plantations of the swampy, subtropical south where malaria was then common.


8 posted on 01/08/2012 3:45:41 PM PST by RegulatorCountry
[ Post Reply | Private Reply | To 7 | View Replies]

To: neverdem

Genetics is very interactive with environment over generations. In particular, if you look at the different geology between Africa, Europe and North America, there is a major difference.

Geologically, Africa is a very old continent, and most of its salts and metals have been leached out of its topsoil in the places where humans have existed for a long time.

However, Europe and North America are geologically much more recent, and their topsoil still has much higher concentrations of both salts and metals.

Therefore, when Africans came to the US, it should be expected that they would eventually suffer from chronic exposures to salts and metals that would not affect those of European ancestry.

And, lo and behold, they do. This goes a long way to explain the very high incidence of hypertension (around 50% after the age of 40), and the even greater susceptibility of black children to lead exposure, which while it can harm all children, tends to harm black children worse.

But this also points the way to prevention and treatment.


9 posted on 01/08/2012 3:49:59 PM PST by yefragetuwrabrumuy
[ Post Reply | Private Reply | To 1 | View Replies]

To: RegulatorCountry

The whole indentured servant/slavery thing was pretty convoluted with a lot of legal wrangling going on from the earliest days.

The Puritans themselves seemed to support slavery but only as a means of bringing them out of Africa and to God with freedom being the eventual goal. (different world then so I’m not qualified to judge them)


10 posted on 01/08/2012 3:57:18 PM PST by cripplecreek (Stand with courage or shut up and do as you're told.)
[ Post Reply | Private Reply | To 8 | View Replies]

To: cripplecreek

Went to your Wiki link, didn’t mean to sound dismissive. Some of the info is at odds with my own. “Mary” instead of Juana or Juanita, which seemed pretty well established at the time I looked into it.

I’ll have to look at their source for this and correct my own info if necessary.

We’ve been so steeped in efforts to eradicate bias based upon prior enslavement that the attitudes of the era don’t even enter our minds, and sound very strange. People living in more primitive societies were regarded as savages. Enslavement but being brought to God was regarded as an improvement, by those doing the enslaving of course.

Not to get too Eurocentric upon the matter, though, slavery was known in North America before the first European arrived. Native tribes enslaved one another after wars. The Cherokee weren’t well regarded by certain other tribes because of this. Africans enslaved one another as well.

It’s a myopic misperception, that chattel slavery was a unique sin of the American southeast. It might have been the most prominent due to the Civil War. But it was not in isolation. Practically the whole world had it in one form or another, to the point that I’d honestly doubt if there is a people that can claim to have never been enslaved, or to have held them.


11 posted on 01/08/2012 4:15:57 PM PST by RegulatorCountry
[ Post Reply | Private Reply | To 10 | View Replies]

To: neverdem
the harsh conditions of their new environment in America.

Oh yeah, because conditions on the veldt were so idyllic.

12 posted on 01/08/2012 5:12:31 PM PST by IronJack (=)
[ Post Reply | Private Reply | To 1 | View Replies]

To: neverdem

Quadruple reparationz.


13 posted on 01/08/2012 5:31:44 PM PST by MrBambaLaMamba (This Message Contains Privileged Attorney-Client Communications)
[ Post Reply | Private Reply | To 1 | View Replies]

To: El Gato; Ernest_at_the_Beach; Robert A. Cook, PE; lepton; LadyDoc; jb6; tiamat; PGalt; Dianna; ...
This Ancient, Deadly Disease Is Still Killing In Europe

Hormone in Women Linked to Dementia, Study Finds

MSU scientists crack medieval bone code

How Yoga Can Wreck Your Body

FReepmail me if you want on or off my health and science ping list.

14 posted on 01/08/2012 6:10:43 PM PST by neverdem (Xin loi minh oi)
[ Post Reply | Private Reply | To 1 | View Replies]

To: yefragetuwrabrumuy

It is really quite simple. The climate in which most sub-Saharan Africans evolved was warm and humid. The population evolved to be able to sweat heavily in order to survive in such a stressful climate. Black Africans have more sweat glands than either Europeans or Asians.

The downside of this is that if one sweats too heavily over a long period, one becomes depleted in salts, and will pass out and possibly die. For this reason, the Africans evolved the ability to conserve salts in the body. It works.

The downside is that the tendency to retain salts favors the development of high blood-pressure. This is probably one reason for the high rate of blood-pressure problems in Americans of African ancestry. Evolution has trade-offs, just like engineering!

So, if you have that ancestry, you should be aware of the risk. And if you are European by ancestry, you should watch for skin cancer, which is very rare (almost unknown) among people with a generous endowment of melanin.

Blacks should also check Vitamin-D levels, especially during the winter. Dark skin inhibits the formation of Vitamin-D, which helps fight viral and bacterial infections (even TB, according to some studies!). Fortunately, Vitamin-D is cheap, and has no bad side-effects. Ask your doctor about this.


15 posted on 01/08/2012 8:48:27 PM PST by docbnj
[ Post Reply | Private Reply | To 9 | View Replies]

To: yefragetuwrabrumuy

It is really quite simple. The climate in which most sub-Saharan Africans evolved was warm and humid. The population evolved to be able to sweat heavily in order to survive in such a stressful climate. Black Africans have more sweat glands than either Europeans or Asians.

The downside of this is that if one sweats too heavily over a long period, one becomes depleted in salts, and will pass out and possibly die. For this reason, the Africans evolved the ability to conserve salts in the body. It works.

The downside is that the tendency to retain salts favors the development of high blood-pressure. This is probably one reason for the high rate of blood-pressure problems in Americans of African ancestry. Evolution has trade-offs, just like engineering!

So, if you have that ancestry, you should be aware of the risk. And if you are European by ancestry, you should watch for skin cancer, which is very rare (almost unknown) among people with a generous endowment of melanin.

Blacks should also check Vitamin-D levels, especially during the winter. Dark skin inhibits the formation of Vitamin-D, which helps fight viral and bacterial infections (even TB, according to some studies!). Fortunately, Vitamin-D is cheap, and has no bad side-effects. Ask your doctor about this.


16 posted on 01/08/2012 8:48:49 PM PST by docbnj
[ Post Reply | Private Reply | To 9 | View Replies]

To: cripplecreek; RegulatorCountry

More about Johnson and others from Angola http://www.eclectica.org/v5n3/hashaw.html


17 posted on 01/09/2012 1:28:50 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 7 | View Replies]

To: AdmSmith

Thanks for that link, interesting info, some of which I hadn’t seen before. Lends support to the given name Juanita, but still has Anthony Johnson’s wife as Mary.

These communities were almost always on the edge of state jurisdictions, and many still are. If trouble came, due to their mixed ancestry on the one hand or due to the “outlaw” behavior assumed by some over the centuries, that made it a fairly simple matter to evade all but the most serious of legal issues. Just jump over the border.

Many of the surnames listed are known in the present day in the Lumbee Indians of the Robeson County/Lumberton/Fayetteville, NC area, most prominently Chavis, Locklear and Oxendine.

I have an ancestor or two who belon


18 posted on 01/09/2012 3:59:24 AM PST by RegulatorCountry
[ Post Reply | Private Reply | To 17 | View Replies]

To: gorush
"Ah jeez. Under 400 years and it shows up in the genome...color me skeptical."

Small population, confined breeding groups, high survival-threat stress. See Ashkenazi Jews for similar phenomena.

19 posted on 01/09/2012 4:00:09 AM PST by Wonder Warthog
[ Post Reply | Private Reply | To 2 | View Replies]

To: RegulatorCountry
"The false premise here is that early African-Americans as a group were free to “select” and reproduce."

You misunderstand "natural selection". All that is necessary for natural selection is small, genetically isolated groups and differing environmental (or other) stress on survival rates. It has nothing to do with mate picking or any other "freedom of choice" phenomenon.

20 posted on 01/09/2012 4:03:17 AM PST by Wonder Warthog
[ Post Reply | Private Reply | To 4 | View Replies]


Navigation: use the links below to view more comments.
first 1-20, 21-25 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson